Mutagenetix > Incidental Mutations

Incidental Mutation 'R2191:Cr2'

238076

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

040193-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R2191 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 195163381 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 465 (I465F)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

Predicted Effect

probably benign
Transcript: ENSMUST00000043104

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: I89F

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: I89F

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193356

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably benign
Transcript: ENSMUST00000195120
AA Change: I89F

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: I89F

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195347

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210219
AA Change: I465F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	G	6: 23,078,866	S716P	possibly damaging	Het
Abcb5	A	C	12: 118,867,956	N1220K	probably damaging	Het
Acsl3	A	T	1: 78,699,140	E479D	probably damaging	Het
Actn1	A	T	12: 80,171,802	L736*	probably null	Het
Adcyap1	A	G	17: 93,200,026	S5G	possibly damaging	Het
Adgrv1	T	C	13: 81,566,290	N958S	possibly damaging	Het
Armc1	T	A	3: 19,134,061	N274Y	probably damaging	Het
Atp9b	G	A	18: 80,753,051	R926W	probably damaging	Het
Cacna1e	G	T	1: 154,443,845	Q1370K	probably damaging	Het
Ccdc129	A	T	6: 55,967,719	Q475L	probably benign	Het
Cdip1	C	T	16: 4,770,063	S12N	probably benign	Het
Chrna3	T	A	9: 55,016,045	I160F	probably damaging	Het
Cnot1	A	G	8: 95,761,426	I534T	probably damaging	Het
Daw1	A	G	1: 83,192,663	D232G	probably benign	Het
Dcaf6	T	C	1: 165,422,864	T144A	probably benign	Het
Dhx30	A	T	9: 110,086,118		probably null	Het
Dnah7a	A	G	1: 53,605,875	S1001P	possibly damaging	Het
Dnajb9	T	C	12: 44,207,073	T184A	probably benign	Het
Dsg1b	T	C	18: 20,409,618	*1061Q	probably null	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Edem3	T	A	1: 151,796,883	V450D	probably damaging	Het
Ephb6	G	T	6: 41,616,085	R419L	possibly damaging	Het
Fbxo10	G	C	4: 45,044,811	P608R	probably damaging	Het
Flrt1	A	G	19: 7,095,829	I451T	probably damaging	Het
Gm6309	A	T	5: 146,168,871	V161E	possibly damaging	Het
Gm884	A	C	11: 103,618,967		probably benign	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Igsf1	C	A	X: 49,783,150	L714F	probably damaging	Het
Inpp4b	C	T	8: 81,997,302	P488S	probably damaging	Het
Ints6l	T	A	X: 56,504,750	H678Q	probably benign	Het
Kdm2a	A	T	19: 4,356,931		probably null	Het
Khdrbs3	G	T	15: 69,092,960	V249F	probably damaging	Het
Kmt2d	A	T	15: 98,861,049		probably null	Het
Laptm4a	T	C	12: 8,922,296		probably null	Het
Lrp2bp	C	T	8: 46,013,169	T105I	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mtmr3	A	T	11: 4,499,032	W244R	probably damaging	Het
Myo18a	A	G	11: 77,818,615	D138G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,662	I275L	probably benign	Het
Nol6	C	T	4: 41,118,720	R719H	probably benign	Het
Olfr191	A	T	16: 59,085,675	D269E	probably benign	Het
Olfr441	T	C	6: 43,116,065	S108P	probably benign	Het
Olfr937	A	T	9: 39,060,405	I87K	probably benign	Het
Omt2b	G	A	9: 78,328,175		probably benign	Het
Pclo	C	T	5: 14,713,848	L4112F	unknown	Het
Pglyrp2	T	C	17: 32,415,957	N477S	probably benign	Het
Phf20	T	C	2: 156,276,654	V426A	probably benign	Het
Pla2g4e	CTT	CTTT	2: 120,191,199		probably null	Het
Plagl1	A	C	10: 13,128,941		probably benign	Het
Ppip5k2	A	G	1: 97,744,110	V479A	probably damaging	Het
Prkdc	A	C	16: 15,698,824	T1021P	probably damaging	Het
Rdh7	C	T	10: 127,888,598	V6I	probably benign	Het
Rictor	A	T	15: 6,759,614	H237L	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Rttn	T	C	18: 89,095,648		probably null	Het
Setd5	C	T	6: 113,111,429	Q173*	probably null	Het
Sipa1l1	T	A	12: 82,396,691	Y918*	probably null	Het
Slc13a1	T	G	6: 24,134,397	E162D	possibly damaging	Het
Slc39a9	G	A	12: 80,662,527	A52T	probably damaging	Het
Srebf1	T	C	11: 60,220,539	D2G	probably damaging	Het
Stab1	A	T	14: 31,142,800	M66K	probably benign	Het
Stab1	T	C	14: 31,159,270	N601S	probably damaging	Het
Sv2b	C	T	7: 75,124,088	G545D	probably damaging	Het
Syt5	G	A	7: 4,543,089	Q101*	probably null	Het
Thada	A	G	17: 84,446,521	F341L	probably benign	Het
Tln2	T	G	9: 67,355,221	I585L	probably damaging	Het
Tmem67	C	G	4: 12,069,413		probably null	Het
Tonsl	G	T	15: 76,632,680	L917M	probably damaging	Het
Ttk	A	G	9: 83,862,183	K519E	probably damaging	Het
Ttn	T	C	2: 76,707,134	T34817A	probably benign	Het
Ubr1	A	T	2: 120,926,047	S700T	probably damaging	Het
Unc13b	C	A	4: 43,245,566	C1312*	probably null	Het
Usp36	A	G	11: 118,285,023	L104P	possibly damaging	Het
Vmn1r216	T	C	13: 23,099,233	F29L	probably benign	Het
Vmn1r225	T	C	17: 20,502,885	I196T	probably damaging	Het
Vmn1r50	T	C	6: 90,108,139	F289L	probably benign	Het
Ythdf3	T	C	3: 16,203,211		probably benign	Het
Zfp507	T	A	7: 35,794,843	K258N	probably damaging	Het
Zscan5b	A	G	7: 6,231,443	H156R	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TACTTACCACTCTCACAGACTGG -3'
(R):5'- CAGAGATTTCTTGTGACCCTCC -3'

Sequencing Primer
(F):5'- TCACAGACTGGCAGAGCTGTTG -3'
(R):5'- TCCTGAAGTCAAAAATGCTCGG -3'

Posted On

2014-10-02