Incidental Mutation 'R2191:Cr2'
ID238076
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2191 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 195163381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 465 (I465F)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably benign
Transcript: ENSMUST00000043104
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
AA Change: I89F

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: I89F

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194149
Predicted Effect probably benign
Transcript: ENSMUST00000195120
AA Change: I89F

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: I89F

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195347
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: I465F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTTACCACTCTCACAGACTGG -3'
(R):5'- CAGAGATTTCTTGTGACCCTCC -3'

Sequencing Primer
(F):5'- TCACAGACTGGCAGAGCTGTTG -3'
(R):5'- TCCTGAAGTCAAAAATGCTCGG -3'
Posted On2014-10-02