Incidental Mutation 'R2191:Slc13a1'
ID238093
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2191 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24134397 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 162 (E162D)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031713
AA Change: E162D

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: E162D

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176692
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1249:Slc13a1 UTSW 6 24133650 missense probably benign 0.01
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2940:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R6902:Slc13a1 UTSW 6 24097666 missense possibly damaging 0.65
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7536:Slc13a1 UTSW 6 24100331 missense probably damaging 1.00
R7918:Slc13a1 UTSW 6 24118066 missense probably benign 0.35
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAGGCTAAATGTATCTCATGC -3'
(R):5'- CTTGACCTTCTGTGTTCTGAAGTAC -3'

Sequencing Primer
(F):5'- AATGACTAGACCCCACTG -3'
(R):5'- TCTGAAATAGTTGACTGTAGAGAGC -3'
Posted On2014-10-02