Incidental Mutation 'R2191:Zscan5b'
ID 238101
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfp371, Zfg1
MMRRC Submission 040193-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2191 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 6225277-6242416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6234442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 156 (H156R)
Ref Sequence ENSEMBL: ENSMUSP00000126044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: H156R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: H156R

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: H156R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: H156R

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,865 (GRCm39) S716P possibly damaging Het
Abcb5 A C 12: 118,831,691 (GRCm39) N1220K probably damaging Het
Acsl3 A T 1: 78,676,857 (GRCm39) E479D probably damaging Het
Actn1 A T 12: 80,218,576 (GRCm39) L736* probably null Het
Adcyap1 A G 17: 93,507,454 (GRCm39) S5G possibly damaging Het
Adgrv1 T C 13: 81,714,409 (GRCm39) N958S possibly damaging Het
Armc1 T A 3: 19,188,225 (GRCm39) N274Y probably damaging Het
Atp9b G A 18: 80,796,266 (GRCm39) R926W probably damaging Het
Cacna1e G T 1: 154,319,591 (GRCm39) Q1370K probably damaging Het
Cdip1 C T 16: 4,587,927 (GRCm39) S12N probably benign Het
Chrna3 T A 9: 54,923,329 (GRCm39) I160F probably damaging Het
Cnot1 A G 8: 96,488,054 (GRCm39) I534T probably damaging Het
Cr2 T A 1: 194,845,689 (GRCm39) I465F possibly damaging Het
Daw1 A G 1: 83,170,384 (GRCm39) D232G probably benign Het
Dcaf6 T C 1: 165,250,433 (GRCm39) T144A probably benign Het
Dhx30 A T 9: 109,915,186 (GRCm39) probably null Het
Dnah7a A G 1: 53,645,034 (GRCm39) S1001P possibly damaging Het
Dnajb9 T C 12: 44,253,856 (GRCm39) T184A probably benign Het
Dsg1b T C 18: 20,542,675 (GRCm39) *1061Q probably null Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Edem3 T A 1: 151,672,634 (GRCm39) V450D probably damaging Het
Ephb6 G T 6: 41,593,019 (GRCm39) R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 (GRCm39) P608R probably damaging Het
Flrt1 A G 19: 7,073,194 (GRCm39) I451T probably damaging Het
Gm6309 A T 5: 146,105,681 (GRCm39) V161E possibly damaging Het
Heatr5b A G 17: 79,081,106 (GRCm39) L1382P probably damaging Het
Igsf1 C A X: 48,872,027 (GRCm39) L714F probably damaging Het
Inpp4b C T 8: 82,723,931 (GRCm39) P488S probably damaging Het
Ints6l T A X: 55,550,110 (GRCm39) H678Q probably benign Het
Itprid1 A T 6: 55,944,704 (GRCm39) Q475L probably benign Het
Kdm2a A T 19: 4,406,959 (GRCm39) probably null Het
Khdrbs3 G T 15: 68,964,809 (GRCm39) V249F probably damaging Het
Kmt2d A T 15: 98,758,930 (GRCm39) probably null Het
Laptm4a T C 12: 8,972,296 (GRCm39) probably null Het
Lrp2bp C T 8: 46,466,206 (GRCm39) T105I probably benign Het
Lrrc37 A C 11: 103,509,793 (GRCm39) probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Mtmr3 A T 11: 4,449,032 (GRCm39) W244R probably damaging Het
Myo18a A G 11: 77,709,441 (GRCm39) D138G probably damaging Het
Nlrp9b A T 7: 19,757,587 (GRCm39) I275L probably benign Het
Nol6 C T 4: 41,118,720 (GRCm39) R719H probably benign Het
Omt2b G A 9: 78,235,457 (GRCm39) probably benign Het
Or2a54 T C 6: 43,092,999 (GRCm39) S108P probably benign Het
Or5h23 A T 16: 58,906,038 (GRCm39) D269E probably benign Het
Or8g23 A T 9: 38,971,701 (GRCm39) I87K probably benign Het
Pclo C T 5: 14,763,862 (GRCm39) L4112F unknown Het
Pglyrp2 T C 17: 32,634,931 (GRCm39) N477S probably benign Het
Phf20 T C 2: 156,118,574 (GRCm39) V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,021,680 (GRCm39) probably null Het
Plagl1 A C 10: 13,004,685 (GRCm39) probably benign Het
Ppip5k2 A G 1: 97,671,835 (GRCm39) V479A probably damaging Het
Prkdc A C 16: 15,516,688 (GRCm39) T1021P probably damaging Het
Rdh7 C T 10: 127,724,467 (GRCm39) V6I probably benign Het
Rictor A T 15: 6,789,095 (GRCm39) H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Rttn T C 18: 89,113,772 (GRCm39) probably null Het
Setd5 C T 6: 113,088,390 (GRCm39) Q173* probably null Het
Sipa1l1 T A 12: 82,443,465 (GRCm39) Y918* probably null Het
Slc13a1 T G 6: 24,134,396 (GRCm39) E162D possibly damaging Het
Slc39a9 G A 12: 80,709,301 (GRCm39) A52T probably damaging Het
Srebf1 T C 11: 60,111,365 (GRCm39) D2G probably damaging Het
Stab1 A T 14: 30,864,757 (GRCm39) M66K probably benign Het
Stab1 T C 14: 30,881,227 (GRCm39) N601S probably damaging Het
Sv2b C T 7: 74,773,836 (GRCm39) G545D probably damaging Het
Syt5 G A 7: 4,546,088 (GRCm39) Q101* probably null Het
Thada A G 17: 84,753,949 (GRCm39) F341L probably benign Het
Tln2 T G 9: 67,262,503 (GRCm39) I585L probably damaging Het
Tmem67 C G 4: 12,069,413 (GRCm39) probably null Het
Tonsl G T 15: 76,516,880 (GRCm39) L917M probably damaging Het
Ttk A G 9: 83,744,236 (GRCm39) K519E probably damaging Het
Ttn T C 2: 76,537,478 (GRCm39) T34817A probably benign Het
Ubr1 A T 2: 120,756,528 (GRCm39) S700T probably damaging Het
Unc13b C A 4: 43,245,566 (GRCm39) C1312* probably null Het
Usp36 A G 11: 118,175,849 (GRCm39) L104P possibly damaging Het
Vmn1r216 T C 13: 23,283,403 (GRCm39) F29L probably benign Het
Vmn1r225 T C 17: 20,723,147 (GRCm39) I196T probably damaging Het
Vmn1r50 T C 6: 90,085,121 (GRCm39) F289L probably benign Het
Ythdf3 T C 3: 16,257,375 (GRCm39) probably benign Het
Zfp507 T A 7: 35,494,268 (GRCm39) K258N probably damaging Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6,234,421 (GRCm39) missense probably benign 0.00
R0505:Zscan5b UTSW 7 6,242,074 (GRCm39) missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6,236,911 (GRCm39) missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6,233,425 (GRCm39) missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6,236,850 (GRCm39) missense probably benign 0.00
R1613:Zscan5b UTSW 7 6,233,374 (GRCm39) missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6,242,162 (GRCm39) missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6,241,965 (GRCm39) missense possibly damaging 0.67
R3177:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6,242,189 (GRCm39) makesense probably null
R5624:Zscan5b UTSW 7 6,233,518 (GRCm39) missense probably benign 0.00
R8213:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6,241,834 (GRCm39) missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6,234,472 (GRCm39) missense probably benign 0.00
R9717:Zscan5b UTSW 7 6,234,525 (GRCm39) missense possibly damaging 0.73
X0018:Zscan5b UTSW 7 6,233,275 (GRCm39) missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6,241,948 (GRCm39) missense probably benign 0.00
X0025:Zscan5b UTSW 7 6,241,614 (GRCm39) missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6,233,216 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGAAAACTATATCCAGGC -3'
(R):5'- CACAGCAATGTCTAAGCATGGG -3'

Sequencing Primer
(F):5'- ACTATATCCAGGCTCTTACATGGGG -3'
(R):5'- ATATACATCTATGGTCAGTGTGGCC -3'
Posted On 2014-10-02