Mutagenetix > Incidental Mutations

Incidental Mutation 'R2191:Cnot1'

238109

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040193-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2191 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95761426 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 534 (I534T)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: I534T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I534T

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083277

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: I534T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I534T

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196326

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: I532T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211937

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: I2T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212556

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: I534T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	G	6: 23,078,866	S716P	possibly damaging	Het
Abcb5	A	C	12: 118,867,956	N1220K	probably damaging	Het
Acsl3	A	T	1: 78,699,140	E479D	probably damaging	Het
Actn1	A	T	12: 80,171,802	L736*	probably null	Het
Adcyap1	A	G	17: 93,200,026	S5G	possibly damaging	Het
Adgrv1	T	C	13: 81,566,290	N958S	possibly damaging	Het
Armc1	T	A	3: 19,134,061	N274Y	probably damaging	Het
Atp9b	G	A	18: 80,753,051	R926W	probably damaging	Het
Cacna1e	G	T	1: 154,443,845	Q1370K	probably damaging	Het
Ccdc129	A	T	6: 55,967,719	Q475L	probably benign	Het
Cdip1	C	T	16: 4,770,063	S12N	probably benign	Het
Chrna3	T	A	9: 55,016,045	I160F	probably damaging	Het
Cr2	T	A	1: 195,163,381	I465F	possibly damaging	Het
Daw1	A	G	1: 83,192,663	D232G	probably benign	Het
Dcaf6	T	C	1: 165,422,864	T144A	probably benign	Het
Dhx30	A	T	9: 110,086,118		probably null	Het
Dnah7a	A	G	1: 53,605,875	S1001P	possibly damaging	Het
Dnajb9	T	C	12: 44,207,073	T184A	probably benign	Het
Dsg1b	T	C	18: 20,409,618	*1061Q	probably null	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Edem3	T	A	1: 151,796,883	V450D	probably damaging	Het
Ephb6	G	T	6: 41,616,085	R419L	possibly damaging	Het
Fbxo10	G	C	4: 45,044,811	P608R	probably damaging	Het
Flrt1	A	G	19: 7,095,829	I451T	probably damaging	Het
Gm6309	A	T	5: 146,168,871	V161E	possibly damaging	Het
Gm884	A	C	11: 103,618,967		probably benign	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Igsf1	C	A	X: 49,783,150	L714F	probably damaging	Het
Inpp4b	C	T	8: 81,997,302	P488S	probably damaging	Het
Ints6l	T	A	X: 56,504,750	H678Q	probably benign	Het
Kdm2a	A	T	19: 4,356,931		probably null	Het
Khdrbs3	G	T	15: 69,092,960	V249F	probably damaging	Het
Kmt2d	A	T	15: 98,861,049		probably null	Het
Laptm4a	T	C	12: 8,922,296		probably null	Het
Lrp2bp	C	T	8: 46,013,169	T105I	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mtmr3	A	T	11: 4,499,032	W244R	probably damaging	Het
Myo18a	A	G	11: 77,818,615	D138G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,662	I275L	probably benign	Het
Nol6	C	T	4: 41,118,720	R719H	probably benign	Het
Olfr191	A	T	16: 59,085,675	D269E	probably benign	Het
Olfr441	T	C	6: 43,116,065	S108P	probably benign	Het
Olfr937	A	T	9: 39,060,405	I87K	probably benign	Het
Omt2b	G	A	9: 78,328,175		probably benign	Het
Pclo	C	T	5: 14,713,848	L4112F	unknown	Het
Pglyrp2	T	C	17: 32,415,957	N477S	probably benign	Het
Phf20	T	C	2: 156,276,654	V426A	probably benign	Het
Pla2g4e	CTT	CTTT	2: 120,191,199		probably null	Het
Plagl1	A	C	10: 13,128,941		probably benign	Het
Ppip5k2	A	G	1: 97,744,110	V479A	probably damaging	Het
Prkdc	A	C	16: 15,698,824	T1021P	probably damaging	Het
Rdh7	C	T	10: 127,888,598	V6I	probably benign	Het
Rictor	A	T	15: 6,759,614	H237L	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Rttn	T	C	18: 89,095,648		probably null	Het
Setd5	C	T	6: 113,111,429	Q173*	probably null	Het
Sipa1l1	T	A	12: 82,396,691	Y918*	probably null	Het
Slc13a1	T	G	6: 24,134,397	E162D	possibly damaging	Het
Slc39a9	G	A	12: 80,662,527	A52T	probably damaging	Het
Srebf1	T	C	11: 60,220,539	D2G	probably damaging	Het
Stab1	T	C	14: 31,159,270	N601S	probably damaging	Het
Stab1	A	T	14: 31,142,800	M66K	probably benign	Het
Sv2b	C	T	7: 75,124,088	G545D	probably damaging	Het
Syt5	G	A	7: 4,543,089	Q101*	probably null	Het
Thada	A	G	17: 84,446,521	F341L	probably benign	Het
Tln2	T	G	9: 67,355,221	I585L	probably damaging	Het
Tmem67	C	G	4: 12,069,413		probably null	Het
Tonsl	G	T	15: 76,632,680	L917M	probably damaging	Het
Ttk	A	G	9: 83,862,183	K519E	probably damaging	Het
Ttn	T	C	2: 76,707,134	T34817A	probably benign	Het
Ubr1	A	T	2: 120,926,047	S700T	probably damaging	Het
Unc13b	C	A	4: 43,245,566	C1312*	probably null	Het
Usp36	A	G	11: 118,285,023	L104P	possibly damaging	Het
Vmn1r216	T	C	13: 23,099,233	F29L	probably benign	Het
Vmn1r225	T	C	17: 20,502,885	I196T	probably damaging	Het
Vmn1r50	T	C	6: 90,108,139	F289L	probably benign	Het
Ythdf3	T	C	3: 16,203,211		probably benign	Het
Zfp507	T	A	7: 35,794,843	K258N	probably damaging	Het
Zscan5b	A	G	7: 6,231,443	H156R	possibly damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AACCAGCCTTTAGGACTGAC -3'
(R):5'- ACAGCAGGGCACTTGACTTC -3'

Sequencing Primer
(F):5'- ACCAGCCTTTAGGACTGACTTACC -3'
(R):5'- AGCAGGGCACTTGACTTCTTATATC -3'

Posted On

2014-10-02