Mutagenetix > Incidental Mutation

Incidental Mutation 'R2191:Usp36'

238125

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

040193-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R2191 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118285023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 104 (L104P)

Ref Sequence

ENSEMBL: ENSMUSP00000101903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092382
AA Change: L104P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: L104P

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106296
AA Change: L104P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: L104P

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151433

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	G	6: 23,078,866	S716P	possibly damaging	Het
Abcb5	A	C	12: 118,867,956	N1220K	probably damaging	Het
Acsl3	A	T	1: 78,699,140	E479D	probably damaging	Het
Actn1	A	T	12: 80,171,802	L736*	probably null	Het
Adcyap1	A	G	17: 93,200,026	S5G	possibly damaging	Het
Adgrv1	T	C	13: 81,566,290	N958S	possibly damaging	Het
Armc1	T	A	3: 19,134,061	N274Y	probably damaging	Het
Atp9b	G	A	18: 80,753,051	R926W	probably damaging	Het
Cacna1e	G	T	1: 154,443,845	Q1370K	probably damaging	Het
Ccdc129	A	T	6: 55,967,719	Q475L	probably benign	Het
Cdip1	C	T	16: 4,770,063	S12N	probably benign	Het
Chrna3	T	A	9: 55,016,045	I160F	probably damaging	Het
Cnot1	A	G	8: 95,761,426	I534T	probably damaging	Het
Cr2	T	A	1: 195,163,381	I465F	possibly damaging	Het
Daw1	A	G	1: 83,192,663	D232G	probably benign	Het
Dcaf6	T	C	1: 165,422,864	T144A	probably benign	Het
Dhx30	A	T	9: 110,086,118		probably null	Het
Dnah7a	A	G	1: 53,605,875	S1001P	possibly damaging	Het
Dnajb9	T	C	12: 44,207,073	T184A	probably benign	Het
Dsg1b	T	C	18: 20,409,618	*1061Q	probably null	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Edem3	T	A	1: 151,796,883	V450D	probably damaging	Het
Ephb6	G	T	6: 41,616,085	R419L	possibly damaging	Het
Fbxo10	G	C	4: 45,044,811	P608R	probably damaging	Het
Flrt1	A	G	19: 7,095,829	I451T	probably damaging	Het
Gm6309	A	T	5: 146,168,871	V161E	possibly damaging	Het
Gm884	A	C	11: 103,618,967		probably benign	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Igsf1	C	A	X: 49,783,150	L714F	probably damaging	Het
Inpp4b	C	T	8: 81,997,302	P488S	probably damaging	Het
Ints6l	T	A	X: 56,504,750	H678Q	probably benign	Het
Kdm2a	A	T	19: 4,356,931		probably null	Het
Khdrbs3	G	T	15: 69,092,960	V249F	probably damaging	Het
Kmt2d	A	T	15: 98,861,049		probably null	Het
Laptm4a	T	C	12: 8,922,296		probably null	Het
Lrp2bp	C	T	8: 46,013,169	T105I	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mtmr3	A	T	11: 4,499,032	W244R	probably damaging	Het
Myo18a	A	G	11: 77,818,615	D138G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,662	I275L	probably benign	Het
Nol6	C	T	4: 41,118,720	R719H	probably benign	Het
Olfr191	A	T	16: 59,085,675	D269E	probably benign	Het
Olfr441	T	C	6: 43,116,065	S108P	probably benign	Het
Olfr937	A	T	9: 39,060,405	I87K	probably benign	Het
Omt2b	G	A	9: 78,328,175		probably benign	Het
Pclo	C	T	5: 14,713,848	L4112F	unknown	Het
Pglyrp2	T	C	17: 32,415,957	N477S	probably benign	Het
Phf20	T	C	2: 156,276,654	V426A	probably benign	Het
Pla2g4e	CTT	CTTT	2: 120,191,199		probably null	Het
Plagl1	A	C	10: 13,128,941		probably benign	Het
Ppip5k2	A	G	1: 97,744,110	V479A	probably damaging	Het
Prkdc	A	C	16: 15,698,824	T1021P	probably damaging	Het
Rdh7	C	T	10: 127,888,598	V6I	probably benign	Het
Rictor	A	T	15: 6,759,614	H237L	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Rttn	T	C	18: 89,095,648		probably null	Het
Setd5	C	T	6: 113,111,429	Q173*	probably null	Het
Sipa1l1	T	A	12: 82,396,691	Y918*	probably null	Het
Slc13a1	T	G	6: 24,134,397	E162D	possibly damaging	Het
Slc39a9	G	A	12: 80,662,527	A52T	probably damaging	Het
Srebf1	T	C	11: 60,220,539	D2G	probably damaging	Het
Stab1	A	T	14: 31,142,800	M66K	probably benign	Het
Stab1	T	C	14: 31,159,270	N601S	probably damaging	Het
Sv2b	C	T	7: 75,124,088	G545D	probably damaging	Het
Syt5	G	A	7: 4,543,089	Q101*	probably null	Het
Thada	A	G	17: 84,446,521	F341L	probably benign	Het
Tln2	T	G	9: 67,355,221	I585L	probably damaging	Het
Tmem67	C	G	4: 12,069,413		probably null	Het
Tonsl	G	T	15: 76,632,680	L917M	probably damaging	Het
Ttk	A	G	9: 83,862,183	K519E	probably damaging	Het
Ttn	T	C	2: 76,707,134	T34817A	probably benign	Het
Ubr1	A	T	2: 120,926,047	S700T	probably damaging	Het
Unc13b	C	A	4: 43,245,566	C1312*	probably null	Het
Vmn1r216	T	C	13: 23,099,233	F29L	probably benign	Het
Vmn1r225	T	C	17: 20,502,885	I196T	probably damaging	Het
Vmn1r50	T	C	6: 90,108,139	F289L	probably benign	Het
Ythdf3	T	C	3: 16,203,211		probably benign	Het
Zfp507	T	A	7: 35,794,843	K258N	probably damaging	Het
Zscan5b	A	G	7: 6,231,443	H156R	possibly damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118269205	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAGTGTTAACAAGTTCAGCTG -3'
(R):5'- ATACAGAGGTTGGACGGGTC -3'

Sequencing Primer
(F):5'- GTGTTAACAAGTTCAGCTGACTCAC -3'
(R):5'- CACACAGTGCGGTGCAAG -3'

Posted On

2014-10-02