Incidental Mutation 'R2191:Abcb5'
ID238133
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R2191 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 118867956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1220 (N1220K)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably damaging
Transcript: ENSMUST00000035515
AA Change: N1220K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: N1220K

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTCTTCATTAGACCAAGATCCAAGC -3'
(R):5'- TCCCCATTTCTATCTGGCAGAG -3'

Sequencing Primer
(F):5'- CCCATGTAAGGCTGGCAG -3'
(R):5'- TTGATAAAGCCCGGAGAG -3'
Posted On2014-10-02