Incidental Mutation 'R2191:Stab1'
ID 238136
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 040193-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2191 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31142800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 66 (M66K)
Ref Sequence ENSEMBL: ENSMUSP00000125542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000227096] [ENSMUST00000227794]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: M1926K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: M1926K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090212
SMART Domains Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 367 1.5e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159208
Predicted Effect probably benign
Transcript: ENSMUST00000159249
AA Change: M66K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286
AA Change: M66K

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect probably benign
Transcript: ENSMUST00000160024
SMART Domains Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
Blast:FAS1 1 32 5e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Predicted Effect probably benign
Transcript: ENSMUST00000226975
Predicted Effect probably benign
Transcript: ENSMUST00000227096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227690
Predicted Effect probably benign
Transcript: ENSMUST00000227794
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31145249 missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31159304 missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 splice site probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 splice site probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
R7213:Stab1 UTSW 14 31143673 missense probably benign
R7215:Stab1 UTSW 14 31160797 missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31140826 missense probably damaging 1.00
R7389:Stab1 UTSW 14 31147239 missense probably benign 0.00
R7400:Stab1 UTSW 14 31157384 missense probably null 1.00
R7427:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7428:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7484:Stab1 UTSW 14 31160317 missense probably benign 0.00
R7568:Stab1 UTSW 14 31152595 missense probably damaging 1.00
R7574:Stab1 UTSW 14 31154665 missense probably benign
R7619:Stab1 UTSW 14 31145237 missense probably benign
R7623:Stab1 UTSW 14 31140621 missense probably benign 0.03
R7721:Stab1 UTSW 14 31141456 missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31154472 missense probably benign 0.01
R7936:Stab1 UTSW 14 31157415 missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31160024 missense probably benign 0.02
R7973:Stab1 UTSW 14 31159633 critical splice donor site probably null
R8059:Stab1 UTSW 14 31160241 missense probably benign 0.02
R8116:Stab1 UTSW 14 31158953 missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31148954 missense probably benign 0.14
R8368:Stab1 UTSW 14 31148411 missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31155833 missense probably damaging 1.00
R8513:Stab1 UTSW 14 31149790 critical splice donor site probably null
R8544:Stab1 UTSW 14 31163051 nonsense probably null
R8671:Stab1 UTSW 14 31157408 missense probably damaging 1.00
R8885:Stab1 UTSW 14 31161814 missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31160822 missense probably benign
R9022:Stab1 UTSW 14 31160269 missense probably benign 0.01
R9059:Stab1 UTSW 14 31154848 missense probably benign 0.01
R9226:Stab1 UTSW 14 31145855 missense probably benign 0.00
R9272:Stab1 UTSW 14 31145341 missense probably benign 0.05
R9388:Stab1 UTSW 14 31154355 missense probably damaging 1.00
R9401:Stab1 UTSW 14 31161112 missense probably benign
R9433:Stab1 UTSW 14 31143574 missense probably benign 0.00
R9450:Stab1 UTSW 14 31162939 missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31155765 missense probably damaging 1.00
R9570:Stab1 UTSW 14 31142681 missense probably benign 0.01
R9624:Stab1 UTSW 14 31141388 missense
R9694:Stab1 UTSW 14 31154944 missense probably benign 0.06
R9723:Stab1 UTSW 14 31163891 missense probably benign 0.10
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31142038 missense probably benign 0.00
Z1176:Stab1 UTSW 14 31150660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAACTGGTCAGGTTGTCTG -3'
(R):5'- TCCATCTCCTCCAGAAGACTTG -3'

Sequencing Primer
(F):5'- GTAACCCTCTGGATGCTTACCATGG -3'
(R):5'- CCAGAAGACTTGCAGCATCTGTG -3'
Posted On 2014-10-02