Incidental Mutation 'R2191:Rictor'
ID 238138
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene Name RPTOR independent companion of MTOR, complex 2
Synonyms D530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 040193-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2191 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 6737860-6829882 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6789095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 237 (H237L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
AlphaFold Q6QI06
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: H237L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: H237L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228918
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,865 (GRCm39) S716P possibly damaging Het
Abcb5 A C 12: 118,831,691 (GRCm39) N1220K probably damaging Het
Acsl3 A T 1: 78,676,857 (GRCm39) E479D probably damaging Het
Actn1 A T 12: 80,218,576 (GRCm39) L736* probably null Het
Adcyap1 A G 17: 93,507,454 (GRCm39) S5G possibly damaging Het
Adgrv1 T C 13: 81,714,409 (GRCm39) N958S possibly damaging Het
Armc1 T A 3: 19,188,225 (GRCm39) N274Y probably damaging Het
Atp9b G A 18: 80,796,266 (GRCm39) R926W probably damaging Het
Cacna1e G T 1: 154,319,591 (GRCm39) Q1370K probably damaging Het
Cdip1 C T 16: 4,587,927 (GRCm39) S12N probably benign Het
Chrna3 T A 9: 54,923,329 (GRCm39) I160F probably damaging Het
Cnot1 A G 8: 96,488,054 (GRCm39) I534T probably damaging Het
Cr2 T A 1: 194,845,689 (GRCm39) I465F possibly damaging Het
Daw1 A G 1: 83,170,384 (GRCm39) D232G probably benign Het
Dcaf6 T C 1: 165,250,433 (GRCm39) T144A probably benign Het
Dhx30 A T 9: 109,915,186 (GRCm39) probably null Het
Dnah7a A G 1: 53,645,034 (GRCm39) S1001P possibly damaging Het
Dnajb9 T C 12: 44,253,856 (GRCm39) T184A probably benign Het
Dsg1b T C 18: 20,542,675 (GRCm39) *1061Q probably null Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Edem3 T A 1: 151,672,634 (GRCm39) V450D probably damaging Het
Ephb6 G T 6: 41,593,019 (GRCm39) R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 (GRCm39) P608R probably damaging Het
Flrt1 A G 19: 7,073,194 (GRCm39) I451T probably damaging Het
Gm6309 A T 5: 146,105,681 (GRCm39) V161E possibly damaging Het
Heatr5b A G 17: 79,081,106 (GRCm39) L1382P probably damaging Het
Igsf1 C A X: 48,872,027 (GRCm39) L714F probably damaging Het
Inpp4b C T 8: 82,723,931 (GRCm39) P488S probably damaging Het
Ints6l T A X: 55,550,110 (GRCm39) H678Q probably benign Het
Itprid1 A T 6: 55,944,704 (GRCm39) Q475L probably benign Het
Kdm2a A T 19: 4,406,959 (GRCm39) probably null Het
Khdrbs3 G T 15: 68,964,809 (GRCm39) V249F probably damaging Het
Kmt2d A T 15: 98,758,930 (GRCm39) probably null Het
Laptm4a T C 12: 8,972,296 (GRCm39) probably null Het
Lrp2bp C T 8: 46,466,206 (GRCm39) T105I probably benign Het
Lrrc37 A C 11: 103,509,793 (GRCm39) probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Mtmr3 A T 11: 4,449,032 (GRCm39) W244R probably damaging Het
Myo18a A G 11: 77,709,441 (GRCm39) D138G probably damaging Het
Nlrp9b A T 7: 19,757,587 (GRCm39) I275L probably benign Het
Nol6 C T 4: 41,118,720 (GRCm39) R719H probably benign Het
Omt2b G A 9: 78,235,457 (GRCm39) probably benign Het
Or2a54 T C 6: 43,092,999 (GRCm39) S108P probably benign Het
Or5h23 A T 16: 58,906,038 (GRCm39) D269E probably benign Het
Or8g23 A T 9: 38,971,701 (GRCm39) I87K probably benign Het
Pclo C T 5: 14,763,862 (GRCm39) L4112F unknown Het
Pglyrp2 T C 17: 32,634,931 (GRCm39) N477S probably benign Het
Phf20 T C 2: 156,118,574 (GRCm39) V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,021,680 (GRCm39) probably null Het
Plagl1 A C 10: 13,004,685 (GRCm39) probably benign Het
Ppip5k2 A G 1: 97,671,835 (GRCm39) V479A probably damaging Het
Prkdc A C 16: 15,516,688 (GRCm39) T1021P probably damaging Het
Rdh7 C T 10: 127,724,467 (GRCm39) V6I probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Rttn T C 18: 89,113,772 (GRCm39) probably null Het
Setd5 C T 6: 113,088,390 (GRCm39) Q173* probably null Het
Sipa1l1 T A 12: 82,443,465 (GRCm39) Y918* probably null Het
Slc13a1 T G 6: 24,134,396 (GRCm39) E162D possibly damaging Het
Slc39a9 G A 12: 80,709,301 (GRCm39) A52T probably damaging Het
Srebf1 T C 11: 60,111,365 (GRCm39) D2G probably damaging Het
Stab1 A T 14: 30,864,757 (GRCm39) M66K probably benign Het
Stab1 T C 14: 30,881,227 (GRCm39) N601S probably damaging Het
Sv2b C T 7: 74,773,836 (GRCm39) G545D probably damaging Het
Syt5 G A 7: 4,546,088 (GRCm39) Q101* probably null Het
Thada A G 17: 84,753,949 (GRCm39) F341L probably benign Het
Tln2 T G 9: 67,262,503 (GRCm39) I585L probably damaging Het
Tmem67 C G 4: 12,069,413 (GRCm39) probably null Het
Tonsl G T 15: 76,516,880 (GRCm39) L917M probably damaging Het
Ttk A G 9: 83,744,236 (GRCm39) K519E probably damaging Het
Ttn T C 2: 76,537,478 (GRCm39) T34817A probably benign Het
Ubr1 A T 2: 120,756,528 (GRCm39) S700T probably damaging Het
Unc13b C A 4: 43,245,566 (GRCm39) C1312* probably null Het
Usp36 A G 11: 118,175,849 (GRCm39) L104P possibly damaging Het
Vmn1r216 T C 13: 23,283,403 (GRCm39) F29L probably benign Het
Vmn1r225 T C 17: 20,723,147 (GRCm39) I196T probably damaging Het
Vmn1r50 T C 6: 90,085,121 (GRCm39) F289L probably benign Het
Ythdf3 T C 3: 16,257,375 (GRCm39) probably benign Het
Zfp507 T A 7: 35,494,268 (GRCm39) K258N probably damaging Het
Zscan5b A G 7: 6,234,442 (GRCm39) H156R possibly damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6,816,071 (GRCm39) missense probably damaging 0.99
IGL00785:Rictor APN 15 6,806,431 (GRCm39) missense probably damaging 1.00
IGL00801:Rictor APN 15 6,824,015 (GRCm39) missense probably damaging 1.00
IGL01072:Rictor APN 15 6,819,043 (GRCm39) missense probably damaging 0.98
IGL01139:Rictor APN 15 6,807,749 (GRCm39) missense probably damaging 1.00
IGL01303:Rictor APN 15 6,738,119 (GRCm39) missense probably benign 0.10
IGL01307:Rictor APN 15 6,804,085 (GRCm39) splice site probably null
IGL01767:Rictor APN 15 6,806,865 (GRCm39) missense probably damaging 1.00
IGL01774:Rictor APN 15 6,799,258 (GRCm39) missense probably damaging 1.00
IGL01800:Rictor APN 15 6,804,182 (GRCm39) missense probably damaging 0.99
IGL02192:Rictor APN 15 6,815,895 (GRCm39) missense probably benign 0.00
IGL02503:Rictor APN 15 6,815,924 (GRCm39) missense probably benign 0.06
IGL02652:Rictor APN 15 6,805,668 (GRCm39) critical splice donor site probably null
IGL02656:Rictor APN 15 6,806,401 (GRCm39) missense probably damaging 0.98
IGL02752:Rictor APN 15 6,816,852 (GRCm39) missense probably benign 0.02
IGL03000:Rictor APN 15 6,798,721 (GRCm39) splice site probably benign
IGL03118:Rictor APN 15 6,788,999 (GRCm39) missense possibly damaging 0.93
IGL03182:Rictor APN 15 6,819,079 (GRCm39) missense probably benign 0.08
Tense UTSW 15 6,788,977 (GRCm39) missense possibly damaging 0.94
Tonus UTSW 15 6,798,815 (GRCm39) critical splice donor site probably null
Torrid UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R0149:Rictor UTSW 15 6,813,588 (GRCm39) missense possibly damaging 0.76
R0288:Rictor UTSW 15 6,816,021 (GRCm39) missense probably benign 0.08
R0304:Rictor UTSW 15 6,815,852 (GRCm39) splice site probably null
R0336:Rictor UTSW 15 6,806,234 (GRCm39) critical splice acceptor site probably null
R0361:Rictor UTSW 15 6,813,588 (GRCm39) missense possibly damaging 0.76
R0423:Rictor UTSW 15 6,803,381 (GRCm39) missense possibly damaging 0.77
R0453:Rictor UTSW 15 6,738,123 (GRCm39) missense probably benign 0.01
R0515:Rictor UTSW 15 6,798,782 (GRCm39) missense probably damaging 1.00
R0630:Rictor UTSW 15 6,823,973 (GRCm39) missense probably damaging 1.00
R0730:Rictor UTSW 15 6,803,467 (GRCm39) splice site probably benign
R0744:Rictor UTSW 15 6,793,759 (GRCm39) critical splice acceptor site probably null
R0836:Rictor UTSW 15 6,793,759 (GRCm39) critical splice acceptor site probably null
R0881:Rictor UTSW 15 6,821,151 (GRCm39) missense probably benign
R1114:Rictor UTSW 15 6,823,486 (GRCm39) nonsense probably null
R1367:Rictor UTSW 15 6,820,119 (GRCm39) splice site probably benign
R1655:Rictor UTSW 15 6,801,693 (GRCm39) missense probably benign 0.00
R1678:Rictor UTSW 15 6,785,952 (GRCm39) missense probably benign 0.07
R1679:Rictor UTSW 15 6,797,571 (GRCm39) missense possibly damaging 0.92
R1754:Rictor UTSW 15 6,764,849 (GRCm39) missense probably damaging 1.00
R1757:Rictor UTSW 15 6,803,343 (GRCm39) missense possibly damaging 0.95
R1762:Rictor UTSW 15 6,786,054 (GRCm39) missense probably benign 0.00
R1914:Rictor UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R1915:Rictor UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R1994:Rictor UTSW 15 6,805,637 (GRCm39) missense probably benign 0.18
R2145:Rictor UTSW 15 6,794,588 (GRCm39) missense probably damaging 1.00
R2182:Rictor UTSW 15 6,801,685 (GRCm39) missense probably damaging 0.96
R2357:Rictor UTSW 15 6,813,043 (GRCm39) missense probably damaging 0.99
R2914:Rictor UTSW 15 6,799,476 (GRCm39) critical splice donor site probably null
R3082:Rictor UTSW 15 6,804,338 (GRCm39) missense probably benign 0.15
R3885:Rictor UTSW 15 6,789,091 (GRCm39) missense probably damaging 1.00
R3900:Rictor UTSW 15 6,818,954 (GRCm39) missense probably benign 0.01
R4376:Rictor UTSW 15 6,816,448 (GRCm39) missense probably benign 0.00
R4611:Rictor UTSW 15 6,816,625 (GRCm39) missense possibly damaging 0.75
R4644:Rictor UTSW 15 6,807,416 (GRCm39) nonsense probably null
R4718:Rictor UTSW 15 6,812,641 (GRCm39) missense possibly damaging 0.81
R4822:Rictor UTSW 15 6,821,161 (GRCm39) missense probably benign 0.01
R4980:Rictor UTSW 15 6,811,141 (GRCm39) missense probably damaging 1.00
R5034:Rictor UTSW 15 6,797,576 (GRCm39) missense probably damaging 0.98
R5179:Rictor UTSW 15 6,825,421 (GRCm39) missense probably damaging 1.00
R5386:Rictor UTSW 15 6,818,985 (GRCm39) missense probably benign 0.37
R5532:Rictor UTSW 15 6,819,046 (GRCm39) missense probably damaging 1.00
R5549:Rictor UTSW 15 6,816,391 (GRCm39) missense probably damaging 1.00
R5715:Rictor UTSW 15 6,780,197 (GRCm39) nonsense probably null
R5733:Rictor UTSW 15 6,812,585 (GRCm39) missense probably benign
R5822:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5848:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5849:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5850:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5854:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5855:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5856:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5936:Rictor UTSW 15 6,813,642 (GRCm39) missense probably damaging 0.99
R6155:Rictor UTSW 15 6,823,458 (GRCm39) missense probably benign 0.44
R6394:Rictor UTSW 15 6,798,790 (GRCm39) missense possibly damaging 0.59
R6549:Rictor UTSW 15 6,825,656 (GRCm39) missense probably damaging 1.00
R6611:Rictor UTSW 15 6,780,140 (GRCm39) missense probably damaging 1.00
R6657:Rictor UTSW 15 6,788,977 (GRCm39) missense possibly damaging 0.94
R6705:Rictor UTSW 15 6,823,493 (GRCm39) missense probably benign 0.00
R6819:Rictor UTSW 15 6,825,517 (GRCm39) critical splice donor site probably null
R6985:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R6989:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7016:Rictor UTSW 15 6,804,361 (GRCm39) critical splice donor site probably null
R7030:Rictor UTSW 15 6,737,934 (GRCm39) critical splice donor site probably null
R7066:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7067:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7216:Rictor UTSW 15 6,798,782 (GRCm39) missense probably damaging 1.00
R7396:Rictor UTSW 15 6,816,462 (GRCm39) missense not run
R7449:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7450:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7452:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7616:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7620:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7643:Rictor UTSW 15 6,798,750 (GRCm39) nonsense probably null
R7699:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7700:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7749:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7750:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7751:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7753:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7841:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7894:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7897:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7898:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7937:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7944:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8062:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8063:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8094:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8119:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8134:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8166:Rictor UTSW 15 6,798,815 (GRCm39) critical splice donor site probably null
R8324:Rictor UTSW 15 6,775,043 (GRCm39) missense probably damaging 1.00
R8343:Rictor UTSW 15 6,807,800 (GRCm39) critical splice donor site probably null
R8691:Rictor UTSW 15 6,816,513 (GRCm39) missense probably damaging 1.00
R8859:Rictor UTSW 15 6,813,067 (GRCm39) missense probably damaging 0.98
R8953:Rictor UTSW 15 6,823,928 (GRCm39) missense probably benign 0.39
R8977:Rictor UTSW 15 6,812,566 (GRCm39) missense probably benign
R9008:Rictor UTSW 15 6,801,610 (GRCm39) splice site probably benign
R9369:Rictor UTSW 15 6,773,848 (GRCm39) missense probably benign 0.00
R9563:Rictor UTSW 15 6,797,562 (GRCm39) missense possibly damaging 0.83
R9695:Rictor UTSW 15 6,816,010 (GRCm39) missense probably benign 0.00
X0020:Rictor UTSW 15 6,785,963 (GRCm39) missense probably benign 0.32
X0060:Rictor UTSW 15 6,816,033 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTAGGGTTTAAGTACATAGTGCTG -3'
(R):5'- TAGCACCCGAGTCTACATTTC -3'

Sequencing Primer
(F):5'- ACTTCAGAACCCAGAGGT -3'
(R):5'- GCTCTTCCAGAGGATCAAAGTTCG -3'
Posted On 2014-10-02