Incidental Mutation 'R0180:Tmem145'
ID23814
Institutional Source Beutler Lab
Gene Symbol Tmem145
Ensembl Gene ENSMUSG00000043843
Gene Nametransmembrane protein 145
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0180 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25306106-25316195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25314699 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 413 (I413V)
Ref Sequence ENSEMBL: ENSMUSP00000104046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108409] [ENSMUST00000119703] [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000108409
AA Change: I413V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104046
Gene: ENSMUSG00000043843
AA Change: I413V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 157 411 7.5e-81 PFAM
low complexity region 486 503 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119703
AA Change: I399V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112676
Gene: ENSMUSG00000043843
AA Change: I399V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 143 397 4.3e-81 PFAM
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128119
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205639
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Tmem145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tmem145 APN 7 25314730 missense possibly damaging 0.88
IGL00958:Tmem145 APN 7 25307357 critical splice donor site probably null
IGL01347:Tmem145 APN 7 25314835 missense probably damaging 0.97
IGL01936:Tmem145 APN 7 25311391 missense probably damaging 0.97
IGL02526:Tmem145 APN 7 25308232 missense probably benign 0.20
IGL02686:Tmem145 APN 7 25314725 missense probably damaging 1.00
IGL03182:Tmem145 APN 7 25314879 missense probably damaging 1.00
R0087:Tmem145 UTSW 7 25307843 missense probably damaging 1.00
R0329:Tmem145 UTSW 7 25308674 splice site probably benign
R0504:Tmem145 UTSW 7 25311362 missense probably damaging 1.00
R1488:Tmem145 UTSW 7 25307435 splice site probably null
R1681:Tmem145 UTSW 7 25314734 missense possibly damaging 0.95
R2352:Tmem145 UTSW 7 25306173 missense probably benign
R3834:Tmem145 UTSW 7 25311361 missense probably damaging 1.00
R4175:Tmem145 UTSW 7 25308793 missense probably benign 0.04
R4414:Tmem145 UTSW 7 25307129 missense probably damaging 1.00
R4485:Tmem145 UTSW 7 25307162 missense possibly damaging 0.76
R4631:Tmem145 UTSW 7 25307825 missense probably benign 0.00
R4983:Tmem145 UTSW 7 25308602 missense probably benign 0.03
R4999:Tmem145 UTSW 7 25309034 missense probably benign 0.04
R5772:Tmem145 UTSW 7 25315614 missense probably benign 0.21
R5821:Tmem145 UTSW 7 25315521 missense probably benign 0.30
R5909:Tmem145 UTSW 7 25308193 missense possibly damaging 0.89
R6021:Tmem145 UTSW 7 25308845 splice site probably null
R6430:Tmem145 UTSW 7 25309038 missense possibly damaging 0.84
R6768:Tmem145 UTSW 7 25308636 missense probably damaging 1.00
R6778:Tmem145 UTSW 7 25311376 missense probably benign 0.04
R7428:Tmem145 UTSW 7 25307165 critical splice donor site probably null
R7536:Tmem145 UTSW 7 25307869 missense probably damaging 1.00
R7748:Tmem145 UTSW 7 25307328 nonsense probably null
R7826:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGAATGCCGGAAGATACCC -3'
(R):5'- CCAAATATGGACGCACTTGTCAATCAG -3'

Sequencing Primer
(F):5'- TGTCCAAGGCAGTCTGAATG -3'
(R):5'- TCAGACGCCAATGAGCAG -3'
Posted On2013-04-16