Incidental Mutation 'R0180:Ubqln3'
ID23818
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104141840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 348 (Y348H)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Y348H

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.2224 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCATCATGTAGGCTTCCACCTTG -3'
(R):5'- AATTGTGACCCTCTGCCCAACC -3'

Sequencing Primer
(F):5'- AAAGCTGGGCATGATGACTTTC -3'
(R):5'- CCCTGGACTTCCACATATGG -3'
Posted On2013-04-16