Mutagenetix > Incidental Mutations

Incidental Mutation 'R0180:Ubqln3'

23818

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R0180 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104141840 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 348 (Y348H)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057254
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Y348H

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.2224

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 89.5%

Validation Efficiency

77% (53/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	T	A	19: 21,652,639	N24Y	probably damaging	Het
2810408A11Rik	A	T	11: 69,898,876	M311K	probably benign	Het
Ackr2	T	C	9: 121,908,916	I119T	probably benign	Het
Adamtsl3	A	G	7: 82,575,990	M336V	probably benign	Het
Adhfe1	T	A	1: 9,563,857	F374I	probably benign	Het
Apob	C	T	12: 8,008,285	Q2256*	probably null	Het
Arg1	T	C	10: 24,916,830	I169V	probably benign	Het
Atxn1	A	G	13: 45,557,548	V636A	probably damaging	Het
B3gnt5	T	A	16: 19,769,100	I23K	possibly damaging	Het
Casc1	A	G	6: 145,183,218		probably benign	Het
Catsperg1	A	T	7: 29,190,431		probably null	Het
Celf3	T	A	3: 94,485,340	F115L	probably damaging	Het
Cep192	T	A	18: 67,835,488	H984Q	probably damaging	Het
Col18a1	A	G	10: 77,096,517	V493A	probably benign	Het
Col5a2	C	T	1: 45,411,460	G376S	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Colec12	A	G	18: 9,848,890	H356R	probably damaging	Het
Cracr2a	T	C	6: 127,604,074		probably null	Het
Ctsr	T	C	13: 61,162,745	H62R	probably damaging	Het
Cyp4f40	G	T	17: 32,659,667	W61L	probably benign	Het
Dnah9	T	G	11: 66,147,290	H140P	probably damaging	Het
Dnm1	T	G	2: 32,327,993	I464L	probably damaging	Het
Dnmt1	G	A	9: 20,908,620	T1409I	probably damaging	Het
Dock1	G	A	7: 135,098,837	D1109N	probably damaging	Het
Efhc1	A	G	1: 20,967,489	M297V	probably benign	Het
Emcn	A	T	3: 137,418,994		probably null	Het
Ephb1	A	T	9: 101,927,504	M905K	probably damaging	Het
Fbxw10	A	G	11: 62,853,096	Y276C	probably benign	Het
Fermt3	C	A	19: 7,002,343	S474I	possibly damaging	Het
Frg1	T	A	8: 41,399,068		probably null	Het
Gbf1	T	C	19: 46,285,722	S1732P	probably benign	Het
Gbp8	A	C	5: 105,031,276	L119R	probably damaging	Het
Gldc	C	T	19: 30,100,817	A927T	possibly damaging	Het
Gm8836	T	A	6: 70,260,405		probably benign	Het
Grhl3	C	T	4: 135,554,530	V344I	probably benign	Het
Hhipl1	T	A	12: 108,328,070	L745H	probably damaging	Het
Ido1	T	C	8: 24,593,140	I90V	possibly damaging	Het
Itpr2	T	A	6: 146,501,909		probably benign	Het
Kif1b	T	G	4: 149,213,659	S1029R	probably damaging	Het
Kmt2a	G	A	9: 44,826,851		probably benign	Het
Limk1	T	C	5: 134,669,261	N215D	probably damaging	Het
Lims2	A	G	18: 31,956,315	K144E	probably benign	Het
Mfsd6l	A	T	11: 68,556,545	Q74L	possibly damaging	Het
Mroh1	T	A	15: 76,428,250	S546T	probably damaging	Het
Ncbp3	T	A	11: 73,064,978		probably null	Het
Nlrx1	G	A	9: 44,255,459	H776Y	possibly damaging	Het
Nptxr	T	C	15: 79,794,403	M228V	probably benign	Het
Nsf	T	A	11: 103,930,780	L13F	probably damaging	Het
Nyap1	T	C	5: 137,738,021	E68G	probably damaging	Het
Olfr550	A	G	7: 102,579,032	Y179C	probably damaging	Het
Olfr9	A	T	10: 128,990,834	R307S	possibly damaging	Het
Pcdhb9	A	G	18: 37,402,254	N434D	probably damaging	Het
Pgm5	T	C	19: 24,815,763	D313G	probably damaging	Het
Pkdcc	G	A	17: 83,221,870		probably null	Het
Pkp1	T	C	1: 135,886,800	K261R	probably benign	Het
Pnpla6	A	G	8: 3,524,250		probably null	Het
Polr3b	A	G	10: 84,622,515	T17A	probably benign	Het
Ppt2	A	T	17: 34,626,503	M98K	probably damaging	Het
Rasal3	T	C	17: 32,399,405	D142G	probably benign	Het
Rbm17	G	A	2: 11,587,779	S295L	probably benign	Het
Rhbdf1	A	T	11: 32,210,042	V153D	possibly damaging	Het
Slc6a3	C	T	13: 73,562,336	T355M	probably damaging	Het
Snrnp35	A	T	5: 124,490,820		probably benign	Het
Sorcs2	A	T	5: 36,153,845	I37N	probably damaging	Het
Tecta	G	T	9: 42,366,813	P1133Q	probably benign	Het
Tmem145	A	G	7: 25,314,699	I413V	probably benign	Het
Trappc11	G	T	8: 47,527,974	T144K	possibly damaging	Het
Triml2	A	T	8: 43,190,309	I223L	probably benign	Het
Ube2g2	T	A	10: 77,630,739	N19K	possibly damaging	Het
Wfs1	A	G	5: 36,967,028	F840L	probably damaging	Het
Zc3h11a	T	C	1: 133,621,611	I771V	probably benign	Het
Zdhhc23	G	A	16: 43,973,703	P203S	probably benign	Het
Zfp106	T	G	2: 120,533,875	T684P	probably damaging	Het
Zfp217	A	T	2: 170,120,137	L90Q	probably damaging	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATCATGTAGGCTTCCACCTTG -3'
(R):5'- AATTGTGACCCTCTGCCCAACC -3'

Sequencing Primer
(F):5'- AAAGCTGGGCATGATGACTTTC -3'
(R):5'- CCCTGGACTTCCACATATGG -3'

Posted On

2013-04-16