Incidental Mutation 'R0180:Ubqln3'
ID 23818
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R0180 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103791047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 348 (Y348H)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Y348H

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.2224 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,630,003 (GRCm39) N24Y probably damaging Het
2810408A11Rik A T 11: 69,789,702 (GRCm39) M311K probably benign Het
Ackr2 T C 9: 121,737,982 (GRCm39) I119T probably benign Het
Adamtsl3 A G 7: 82,225,198 (GRCm39) M336V probably benign Het
Adhfe1 T A 1: 9,634,082 (GRCm39) F374I probably benign Het
Apob C T 12: 8,058,285 (GRCm39) Q2256* probably null Het
Arg1 T C 10: 24,792,728 (GRCm39) I169V probably benign Het
Atxn1 A G 13: 45,711,024 (GRCm39) V636A probably damaging Het
B3gnt5 T A 16: 19,587,850 (GRCm39) I23K possibly damaging Het
Catsperg1 A T 7: 28,889,856 (GRCm39) probably null Het
Celf3 T A 3: 94,392,647 (GRCm39) F115L probably damaging Het
Cep192 T A 18: 67,968,559 (GRCm39) H984Q probably damaging Het
Col18a1 A G 10: 76,932,351 (GRCm39) V493A probably benign Het
Col5a2 C T 1: 45,450,620 (GRCm39) G376S probably damaging Het
Colec12 A G 18: 9,848,890 (GRCm39) H356R probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cracr2a T C 6: 127,581,037 (GRCm39) probably null Het
Ctsr T C 13: 61,310,559 (GRCm39) H62R probably damaging Het
Cyp4f40 G T 17: 32,878,641 (GRCm39) W61L probably benign Het
Dnah9 T G 11: 66,038,116 (GRCm39) H140P probably damaging Het
Dnai7 A G 6: 145,128,944 (GRCm39) probably benign Het
Dnm1 T G 2: 32,218,005 (GRCm39) I464L probably damaging Het
Dnmt1 G A 9: 20,819,916 (GRCm39) T1409I probably damaging Het
Dock1 G A 7: 134,700,566 (GRCm39) D1109N probably damaging Het
Efhc1 A G 1: 21,037,713 (GRCm39) M297V probably benign Het
Emcn A T 3: 137,124,755 (GRCm39) probably null Het
Ephb1 A T 9: 101,804,703 (GRCm39) M905K probably damaging Het
Fbxw10 A G 11: 62,743,922 (GRCm39) Y276C probably benign Het
Fermt3 C A 19: 6,979,711 (GRCm39) S474I possibly damaging Het
Frg1 T A 8: 41,852,105 (GRCm39) probably null Het
Gbf1 T C 19: 46,274,161 (GRCm39) S1732P probably benign Het
Gbp8 A C 5: 105,179,142 (GRCm39) L119R probably damaging Het
Gldc C T 19: 30,078,217 (GRCm39) A927T possibly damaging Het
Gm8836 T A 6: 70,237,389 (GRCm39) probably benign Het
Grhl3 C T 4: 135,281,841 (GRCm39) V344I probably benign Het
Hhipl1 T A 12: 108,294,329 (GRCm39) L745H probably damaging Het
Ido1 T C 8: 25,083,156 (GRCm39) I90V possibly damaging Het
Itpr2 T A 6: 146,403,407 (GRCm39) probably benign Het
Kif1b T G 4: 149,298,116 (GRCm39) S1029R probably damaging Het
Kmt2a G A 9: 44,738,148 (GRCm39) probably benign Het
Limk1 T C 5: 134,698,115 (GRCm39) N215D probably damaging Het
Lims2 A G 18: 32,089,368 (GRCm39) K144E probably benign Het
Mfsd6l A T 11: 68,447,371 (GRCm39) Q74L possibly damaging Het
Mroh1 T A 15: 76,312,450 (GRCm39) S546T probably damaging Het
Ncbp3 T A 11: 72,955,804 (GRCm39) probably null Het
Nlrx1 G A 9: 44,166,756 (GRCm39) H776Y possibly damaging Het
Nptxr T C 15: 79,678,604 (GRCm39) M228V probably benign Het
Nsf T A 11: 103,821,606 (GRCm39) L13F probably damaging Het
Nyap1 T C 5: 137,736,283 (GRCm39) E68G probably damaging Het
Or10p22 A T 10: 128,826,703 (GRCm39) R307S possibly damaging Het
Or51r1 A G 7: 102,228,239 (GRCm39) Y179C probably damaging Het
Pcdhb9 A G 18: 37,535,307 (GRCm39) N434D probably damaging Het
Pgm5 T C 19: 24,793,127 (GRCm39) D313G probably damaging Het
Pkdcc G A 17: 83,529,299 (GRCm39) probably null Het
Pkp1 T C 1: 135,814,538 (GRCm39) K261R probably benign Het
Pnpla6 A G 8: 3,574,250 (GRCm39) probably null Het
Polr3b A G 10: 84,458,379 (GRCm39) T17A probably benign Het
Ppt2 A T 17: 34,845,477 (GRCm39) M98K probably damaging Het
Rasal3 T C 17: 32,618,379 (GRCm39) D142G probably benign Het
Rbm17 G A 2: 11,592,590 (GRCm39) S295L probably benign Het
Rhbdf1 A T 11: 32,160,042 (GRCm39) V153D possibly damaging Het
Slc6a3 C T 13: 73,710,455 (GRCm39) T355M probably damaging Het
Snrnp35 A T 5: 124,628,883 (GRCm39) probably benign Het
Sorcs2 A T 5: 36,311,189 (GRCm39) I37N probably damaging Het
Tecta G T 9: 42,278,109 (GRCm39) P1133Q probably benign Het
Tmem145 A G 7: 25,014,124 (GRCm39) I413V probably benign Het
Trappc11 G T 8: 47,981,009 (GRCm39) T144K possibly damaging Het
Triml2 A T 8: 43,643,346 (GRCm39) I223L probably benign Het
Ube2g2 T A 10: 77,466,573 (GRCm39) N19K possibly damaging Het
Wfs1 A G 5: 37,124,372 (GRCm39) F840L probably damaging Het
Zc3h11a T C 1: 133,549,349 (GRCm39) I771V probably benign Het
Zdhhc23 G A 16: 43,794,066 (GRCm39) P203S probably benign Het
Zfp106 T G 2: 120,364,356 (GRCm39) T684P probably damaging Het
Zfp217 A T 2: 169,962,057 (GRCm39) L90Q probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCATCATGTAGGCTTCCACCTTG -3'
(R):5'- AATTGTGACCCTCTGCCCAACC -3'

Sequencing Primer
(F):5'- AAAGCTGGGCATGATGACTTTC -3'
(R):5'- CCCTGGACTTCCACATATGG -3'
Posted On 2013-04-16