Incidental Mutation 'R2192:Wdfy3'
ID238192
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 040194-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101907542 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1554 (R1554Q)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053177
AA Change: R1554Q

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: R1554Q

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174598
AA Change: R1554Q

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: R1554Q

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: R1554Q

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
R8507:Wdfy3 UTSW 5 101872901 missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101851353 missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 101885198 missense probably benign
R8710:Wdfy3 UTSW 5 101882483 missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 101930085 missense probably benign 0.00
R8749:Wdfy3 UTSW 5 101882580 missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGTTTGGGGTCATTTCCACC -3'
(R):5'- TGAACACTTCATAGAACTGCTCAC -3'

Sequencing Primer
(F):5'- TGGCAATACAGTTGTCCCACGAG -3'
(R):5'- TGCTCACAGAGTCCAGGTAG -3'
Posted On2014-10-02