Incidental Mutation 'R2192:Clstn3'
ID238201
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
MMRRC Submission 040194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124459207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 194 (D194E)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: D231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: D231E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: D194E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: D194E

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150774
SMART Domains Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
Blast:CA 13 64 4e-31 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156040
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTCCATGCTCATCAGACATG -3'
(R):5'- GCCAAGTATACTCATGCCTTCC -3'

Sequencing Primer
(F):5'- ACCATGGGAATTGATGCCCTC -3'
(R):5'- CTTTCACAGGGGTCACATATCAG -3'
Posted On2014-10-02