Incidental Mutation 'R2192:Zfp112'
ID238205
Institutional Source Beutler Lab
Gene Symbol Zfp112
Ensembl Gene ENSMUSG00000052675
Gene Namezinc finger protein 112
Synonyms
MMRRC Submission 040194-MU
Accession Numbers

Genbank: NM_021307; MGI: 1929115

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24112314-24127952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24125438 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 277 (Q277L)
Ref Sequence ENSEMBL: ENSMUSP00000150734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005413] [ENSMUST00000120006] [ENSMUST00000215113]
Predicted Effect probably damaging
Transcript: ENSMUST00000005413
AA Change: Q281L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005413
Gene: ENSMUSG00000052675
AA Change: Q281L

DomainStartEndE-ValueType
KRAB 8 68 7.93e-27 SMART
low complexity region 385 397 N/A INTRINSIC
ZnF_C2H2 523 545 4.11e-2 SMART
ZnF_C2H2 551 573 3.44e-4 SMART
ZnF_C2H2 579 601 1.6e-4 SMART
ZnF_C2H2 607 629 1.5e-4 SMART
ZnF_C2H2 635 657 3.89e-3 SMART
ZnF_C2H2 663 685 1.58e-3 SMART
ZnF_C2H2 691 713 6.42e-4 SMART
ZnF_C2H2 719 741 5.99e-4 SMART
ZnF_C2H2 747 769 7.78e-3 SMART
ZnF_C2H2 775 797 3.95e-4 SMART
ZnF_C2H2 803 825 2.01e-5 SMART
ZnF_C2H2 831 853 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120006
AA Change: Q275L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113031
Gene: ENSMUSG00000052675
AA Change: Q275L

DomainStartEndE-ValueType
KRAB 2 62 7.93e-27 SMART
low complexity region 379 391 N/A INTRINSIC
ZnF_C2H2 517 539 4.11e-2 SMART
ZnF_C2H2 545 567 3.44e-4 SMART
ZnF_C2H2 573 595 1.6e-4 SMART
ZnF_C2H2 601 623 1.5e-4 SMART
ZnF_C2H2 629 651 3.89e-3 SMART
ZnF_C2H2 657 679 1.58e-3 SMART
ZnF_C2H2 685 707 6.42e-4 SMART
ZnF_C2H2 713 735 5.99e-4 SMART
ZnF_C2H2 741 763 7.78e-3 SMART
ZnF_C2H2 769 791 3.95e-4 SMART
ZnF_C2H2 797 819 2.01e-5 SMART
ZnF_C2H2 825 847 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215113
AA Change: Q277L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Zfp112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Zfp112 APN 7 24122243 missense probably damaging 1.00
IGL00575:Zfp112 APN 7 24126332 missense probably damaging 1.00
IGL00944:Zfp112 APN 7 24125596 missense probably benign 0.02
IGL01662:Zfp112 APN 7 24125954 missense probably benign 0.44
IGL03383:Zfp112 APN 7 24125678 missense probably damaging 1.00
2107:Zfp112 UTSW 7 24126841 missense probably damaging 1.00
FR4737:Zfp112 UTSW 7 24125407 small insertion probably benign
R0566:Zfp112 UTSW 7 24125677 missense probably benign 0.09
R0581:Zfp112 UTSW 7 24125863 missense probably damaging 0.97
R0613:Zfp112 UTSW 7 24127028 missense probably benign 0.33
R1521:Zfp112 UTSW 7 24125785 missense probably damaging 0.97
R1614:Zfp112 UTSW 7 24126599 missense probably damaging 1.00
R1827:Zfp112 UTSW 7 24124960 missense probably damaging 1.00
R1906:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R1920:Zfp112 UTSW 7 24125237 missense probably benign 0.01
R2008:Zfp112 UTSW 7 24126751 missense probably damaging 1.00
R2012:Zfp112 UTSW 7 24125300 missense possibly damaging 0.69
R2985:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R4191:Zfp112 UTSW 7 24126143 missense probably benign 0.19
R4373:Zfp112 UTSW 7 24125048 missense probably damaging 0.99
R4374:Zfp112 UTSW 7 24126373 missense probably damaging 1.00
R4674:Zfp112 UTSW 7 24126974 missense probably damaging 1.00
R4676:Zfp112 UTSW 7 24126260 missense probably damaging 0.97
R5023:Zfp112 UTSW 7 24126484 missense probably damaging 0.99
R5198:Zfp112 UTSW 7 24124856 missense possibly damaging 0.49
R6559:Zfp112 UTSW 7 24126463 nonsense probably null
R6835:Zfp112 UTSW 7 24125806 missense probably damaging 1.00
R6946:Zfp112 UTSW 7 24125341 missense probably damaging 0.98
R7263:Zfp112 UTSW 7 24125527 missense probably benign 0.04
R7512:Zfp112 UTSW 7 24125179 missense possibly damaging 0.73
R7533:Zfp112 UTSW 7 24125327 missense possibly damaging 0.58
R7535:Zfp112 UTSW 7 24126710 missense probably damaging 1.00
R8179:Zfp112 UTSW 7 24125638 missense probably benign 0.10
R8516:Zfp112 UTSW 7 24123964 missense probably benign
R8525:Zfp112 UTSW 7 24125897 missense probably benign 0.38
R8701:Zfp112 UTSW 7 24125740 missense probably damaging 1.00
R8756:Zfp112 UTSW 7 24125572 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCACAGTGACAATGAGGAGC -3'
(R):5'- CCCACAAGTGTTAAGAGGGG -3'

Sequencing Primer
(F):5'- CCACAGTGACAATGAGGAGCTATAC -3'
(R):5'- GGAACCATAGTGGACATTCCC -3'
Posted On2014-10-02