Incidental Mutation 'R2193:Ces1b'
ID238270
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 040195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2193 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93079877 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 14 (C14S)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably benign
Transcript: ENSMUST00000109582
AA Change: C14S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: C14S

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 T C 7: 44,253,569 R289G probably benign Het
Bfar A G 16: 13,697,471 N183D probably benign Het
Cdca3 A G 6: 124,831,446 T69A probably damaging Het
Clcn3 T A 8: 60,929,187 I456F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcpp2 A C 17: 23,900,419 D69A probably damaging Het
Dlgap2 T A 8: 14,743,431 I475N possibly damaging Het
Dnah6 T A 6: 73,138,640 M1592L probably damaging Het
Dscaml1 A G 9: 45,685,234 Q792R probably benign Het
Eif2ak4 A G 2: 118,422,266 I440V probably benign Het
Frrs1 T C 3: 116,878,345 S31P probably damaging Het
Isoc2b T C 7: 4,850,824 H117R probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Klf5 C T 14: 99,298,970 probably benign Het
Ltn1 G A 16: 87,427,647 S63F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Oas1f A C 5: 120,851,585 T196P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocln T C 13: 100,539,904 D27G probably damaging Het
Olfr1390 A G 11: 49,340,943 H137R possibly damaging Het
Olfr332 A T 11: 58,489,906 M283K probably damaging Het
Rasgrf2 A C 13: 92,023,713 probably null Het
Sars2 G T 7: 28,748,997 V268L probably damaging Het
Sin3a T A 9: 57,117,477 S1040R possibly damaging Het
Vps9d1 A T 8: 123,252,665 Y39N probably damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
R7992:Ces1b UTSW 8 93060359 missense probably benign 0.34
R8022:Ces1b UTSW 8 93069315 critical splice donor site probably null
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Z1177:Ces1b UTSW 8 93076154 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCTCCCAACATTAAAGAGAGG -3'
(R):5'- TGTGGCTTGGAGGTCCTAAC -3'

Sequencing Primer
(F):5'- GGCCAACTAAAAAGTAATCTGTTTGG -3'
(R):5'- TGGCTTGGAGGTCCTAACAAATACC -3'
Posted On2014-10-02