Incidental Mutation 'R2193:Dcpp2'
ID238284
Institutional Source Beutler Lab
Gene Symbol Dcpp2
Ensembl Gene ENSMUSG00000096278
Gene Namedemilune cell and parotid protein 2
SynonymsEG630537
MMRRC Submission 040195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2193 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23880880-23900787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23900419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 69 (D69A)
Ref Sequence ENSEMBL: ENSMUSP00000126379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088598] [ENSMUST00000168272]
Predicted Effect probably damaging
Transcript: ENSMUST00000088598
AA Change: D69A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085966
Gene: ENSMUSG00000096278
AA Change: D69A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Jacalin 32 159 2.91e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168272
AA Change: D69A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126379
Gene: ENSMUSG00000096278
AA Change: D69A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Jacalin 32 159 2.91e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 T C 7: 44,253,569 R289G probably benign Het
Bfar A G 16: 13,697,471 N183D probably benign Het
Cdca3 A G 6: 124,831,446 T69A probably damaging Het
Ces1b A T 8: 93,079,877 C14S probably benign Het
Clcn3 T A 8: 60,929,187 I456F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlgap2 T A 8: 14,743,431 I475N possibly damaging Het
Dnah6 T A 6: 73,138,640 M1592L probably damaging Het
Dscaml1 A G 9: 45,685,234 Q792R probably benign Het
Eif2ak4 A G 2: 118,422,266 I440V probably benign Het
Frrs1 T C 3: 116,878,345 S31P probably damaging Het
Isoc2b T C 7: 4,850,824 H117R probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Klf5 C T 14: 99,298,970 probably benign Het
Ltn1 G A 16: 87,427,647 S63F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Oas1f A C 5: 120,851,585 T196P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocln T C 13: 100,539,904 D27G probably damaging Het
Olfr1390 A G 11: 49,340,943 H137R possibly damaging Het
Olfr332 A T 11: 58,489,906 M283K probably damaging Het
Rasgrf2 A C 13: 92,023,713 probably null Het
Sars2 G T 7: 28,748,997 V268L probably damaging Het
Sin3a T A 9: 57,117,477 S1040R possibly damaging Het
Vps9d1 A T 8: 123,252,665 Y39N probably damaging Het
Other mutations in Dcpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Dcpp2 APN 17 23900635 missense possibly damaging 0.82
R1183:Dcpp2 UTSW 17 23900494 missense probably benign 0.06
R1482:Dcpp2 UTSW 17 23900542 missense probably damaging 1.00
R3983:Dcpp2 UTSW 17 23900573 nonsense probably null
R5426:Dcpp2 UTSW 17 23899313 missense possibly damaging 0.92
R5554:Dcpp2 UTSW 17 23900571 missense probably damaging 0.99
R6042:Dcpp2 UTSW 17 23898912 missense probably damaging 0.99
R6734:Dcpp2 UTSW 17 23900571 missense probably damaging 0.99
R7827:Dcpp2 UTSW 17 23900592 missense probably damaging 1.00
R8220:Dcpp2 UTSW 17 23900692 missense possibly damaging 0.89
R8283:Dcpp2 UTSW 17 23899410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTCCTCTCATACTGAGTAG -3'
(R):5'- ACAAGGCTGGGATCATCAGG -3'

Sequencing Primer
(F):5'- CCTCTCATACTGAGTAGTGAGC -3'
(R):5'- GCTAGAGTACTGATAATTACCCACG -3'
Posted On2014-10-02