Incidental Mutation 'R2194:Rnf40'
ID238293
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Namering finger protein 40
Synonyms
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2194 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location127588767-127604799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127597235 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 785 (A785D)
Ref Sequence ENSEMBL: ENSMUSP00000146310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect probably damaging
Transcript: ENSMUST00000033088
AA Change: A745D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816
AA Change: A745D

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205694
AA Change: A785D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206724
Predicted Effect probably damaging
Transcript: ENSMUST00000206914
AA Change: A685D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127590716 splice site probably benign
IGL02331:Rnf40 APN 7 127589827 missense probably benign
IGL02626:Rnf40 APN 7 127596572 missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127591429 nonsense probably null
IGL02889:Rnf40 APN 7 127591429 nonsense probably null
IGL03353:Rnf40 APN 7 127592891 nonsense probably null
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127596860 synonymous probably null
R0554:Rnf40 UTSW 7 127602584 missense probably damaging 1.00
R0563:Rnf40 UTSW 7 127592876 missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127590615 missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127596334 missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127591784 missense probably damaging 0.99
R2356:Rnf40 UTSW 7 127591576 missense probably damaging 0.99
R4839:Rnf40 UTSW 7 127592640 nonsense probably null
R5071:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127596089 missense probably benign 0.05
R5547:Rnf40 UTSW 7 127589130 critical splice donor site probably null
R5871:Rnf40 UTSW 7 127591585 missense probably damaging 0.97
R6767:Rnf40 UTSW 7 127596585 missense possibly damaging 0.88
R6834:Rnf40 UTSW 7 127596406 missense probably benign 0.18
R6969:Rnf40 UTSW 7 127596323 missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127594677 missense probably damaging 1.00
R7626:Rnf40 UTSW 7 127589875 missense probably benign
R8177:Rnf40 UTSW 7 127596150 missense probably benign
X0026:Rnf40 UTSW 7 127594695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTTAAGTGCCATCAGC -3'
(R):5'- TTCTGTACGGTCAGCAGCTG -3'

Sequencing Primer
(F):5'- ACTGTTTCTTTGGAGTTCCCCGG -3'
(R):5'- CATCCACCTGAGGAGGGAAGC -3'
Posted On2014-10-02