Incidental Mutation 'R2194:Polb'
ID238294
Institutional Source Beutler Lab
Gene Symbol Polb
Ensembl Gene ENSMUSG00000031536
Gene Namepolymerase (DNA directed), beta
SynonymsPol beta, A430088C08Rik
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22628126-22653435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22647467 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 89 (R89H)
Ref Sequence ENSEMBL: ENSMUSP00000148216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033938] [ENSMUST00000210950]
Predicted Effect probably benign
Transcript: ENSMUST00000033938
AA Change: R89H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: R89H

DomainStartEndE-ValueType
POLXc 10 334 4.58e-159 SMART
HhH1 57 76 1.91e-1 SMART
HhH1 98 117 1.14e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181668
Predicted Effect probably benign
Transcript: ENSMUST00000210950
AA Change: R89H

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Polb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Polb APN 8 22653072 missense probably damaging 1.00
IGL02421:Polb APN 8 22640373 missense probably damaging 1.00
IGL02618:Polb APN 8 22637093 missense probably damaging 1.00
IGL02850:Polb APN 8 22648261 splice site probably benign
IGL03143:Polb APN 8 22640351 splice site probably benign
IGL02796:Polb UTSW 8 22631458 missense probably damaging 1.00
R0280:Polb UTSW 8 22640392 missense probably damaging 0.99
R0383:Polb UTSW 8 22639995 nonsense probably null
R0788:Polb UTSW 8 22642338 missense probably null
R1374:Polb UTSW 8 22653057 splice site probably benign
R1564:Polb UTSW 8 22630341 critical splice donor site probably null
R2295:Polb UTSW 8 22653319 missense probably damaging 1.00
R2314:Polb UTSW 8 22640002 missense possibly damaging 0.69
R4992:Polb UTSW 8 22645071 missense probably damaging 0.97
R5107:Polb UTSW 8 22645046 splice site probably null
R5474:Polb UTSW 8 22630370 missense probably benign 0.13
R5905:Polb UTSW 8 22639995 nonsense probably null
R5908:Polb UTSW 8 22642303 critical splice donor site probably null
R6028:Polb UTSW 8 22639995 nonsense probably null
R6188:Polb UTSW 8 22647447 missense probably damaging 0.99
R7304:Polb UTSW 8 22639959 missense probably benign
R7644:Polb UTSW 8 22640427 missense probably benign 0.02
R7766:Polb UTSW 8 22653091 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTGCAAGTAAGTACTGGAGTG -3'
(R):5'- GAGATGAGAAGTCTGTAGCTACTCTG -3'

Sequencing Primer
(F):5'- TGAGAGCTGACATTGGGAGG -3'
(R):5'- GAAGTCTGTAGCTACTCTGTTACTAC -3'
Posted On2014-10-02