Incidental Mutation 'R2194:Mfsd4b4'
ID238295
Institutional Source Beutler Lab
Gene Symbol Mfsd4b4
Ensembl Gene ENSMUSG00000096687
Gene Namemajor facilitator superfamily domain containing 4B4
SynonymsAA474331
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39890018-39899238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39892923 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 104 (N104I)
Ref Sequence ENSEMBL: ENSMUSP00000136934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178045] [ENSMUST00000178563]
Predicted Effect probably damaging
Transcript: ENSMUST00000178045
AA Change: N104I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136934
Gene: ENSMUSG00000096687
AA Change: N104I

DomainStartEndE-ValueType
Pfam:MFS_1 4 368 3e-14 PFAM
transmembrane domain 381 403 N/A INTRINSIC
low complexity region 431 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178563
AA Change: N58I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137516
Gene: ENSMUSG00000096687
AA Change: N58I

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 182 204 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Mfsd4b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01957:Mfsd4b4 APN 10 39892029 missense probably damaging 0.99
IGL03069:Mfsd4b4 APN 10 39892315 missense probably benign 0.04
R0771:Mfsd4b4 UTSW 10 39892411 missense probably benign 0.01
R1411:Mfsd4b4 UTSW 10 39892140 missense probably damaging 1.00
R1472:Mfsd4b4 UTSW 10 39891864 missense probably benign 0.44
R1927:Mfsd4b4 UTSW 10 39892441 missense probably damaging 1.00
R3748:Mfsd4b4 UTSW 10 39894136 splice site probably benign
R5172:Mfsd4b4 UTSW 10 39894087 missense probably damaging 1.00
R5281:Mfsd4b4 UTSW 10 39892471 missense probably benign 0.02
R5771:Mfsd4b4 UTSW 10 39892639 missense probably benign 0.01
R5975:Mfsd4b4 UTSW 10 39892470 missense probably benign 0.21
R6066:Mfsd4b4 UTSW 10 39892053 missense probably benign 0.02
R6954:Mfsd4b4 UTSW 10 39891952 missense probably benign 0.05
R7042:Mfsd4b4 UTSW 10 39892518 missense probably damaging 1.00
R7774:Mfsd4b4 UTSW 10 39892411 missense probably benign 0.01
R8271:Mfsd4b4 UTSW 10 39892105 missense probably benign
Z1176:Mfsd4b4 UTSW 10 39892599 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGCTTCAAAGGATTGGTTCAAG -3'
(R):5'- TAGAGGGGCAGTGGTTTACC -3'

Sequencing Primer
(F):5'- ATTGGTTCAAGGCTAAACGGTC -3'
(R):5'- AGATTCTGTATGTTAGGAGGAGATGC -3'
Posted On2014-10-02