Incidental Mutation 'R2194:Olfr331'
ID238297
Institutional Source Beutler Lab
Gene Symbol Olfr331
Ensembl Gene ENSMUSG00000058807
Gene Nameolfactory receptor 331
SynonymsGA_x6K02T2NKPP-912840-913784, MOR275-4
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58501598-58502572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58501642 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 305 (K305E)
Ref Sequence ENSEMBL: ENSMUSP00000132693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081743] [ENSMUST00000170501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081743
AA Change: K311E

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080440
Gene: ENSMUSG00000058807
AA Change: K311E

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1e-42 PFAM
Pfam:7tm_1 45 299 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170501
AA Change: K305E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132693
Gene: ENSMUSG00000058807
AA Change: K305E

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:7tm_1 39 292 4.9e-28 PFAM
Pfam:7tm_4 141 285 3.6e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Olfr331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Olfr331 APN 11 58502194 missense possibly damaging 0.89
IGL02458:Olfr331 APN 11 58502247 missense probably benign 0.20
IGL02971:Olfr331 APN 11 58502385 missense probably damaging 1.00
IGL03346:Olfr331 APN 11 58501755 missense possibly damaging 0.76
R0416:Olfr331 UTSW 11 58502396 missense unknown
R1547:Olfr331 UTSW 11 58501825 missense probably damaging 1.00
R1697:Olfr331 UTSW 11 58501676 missense probably damaging 1.00
R1717:Olfr331 UTSW 11 58502059 missense probably benign 0.09
R1721:Olfr331 UTSW 11 58501939 missense probably damaging 1.00
R3606:Olfr331 UTSW 11 58502131 missense possibly damaging 0.49
R4457:Olfr331 UTSW 11 58502118 missense probably damaging 1.00
R4766:Olfr331 UTSW 11 58501668 missense probably damaging 1.00
R4858:Olfr331 UTSW 11 58501909 missense probably damaging 1.00
R5475:Olfr331 UTSW 11 58501605 missense probably benign 0.10
R5822:Olfr331 UTSW 11 58501638 missense possibly damaging 0.61
R6337:Olfr331 UTSW 11 58502012 nonsense probably null
R6416:Olfr331 UTSW 11 58502340 missense probably damaging 1.00
R7101:Olfr331 UTSW 11 58502553 missense probably benign 0.00
R7108:Olfr331 UTSW 11 58502554 missense probably benign
RF035:Olfr331 UTSW 11 58502382 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGATAAGACCTTTGTCCCATG -3'
(R):5'- ACTGTGGTCACCCTCTACTATGG -3'

Sequencing Primer
(F):5'- GACCTTTGTCCCATGAAATTAAACAG -3'
(R):5'- GGTCACCCTCTACTATGGTGCTG -3'
Posted On2014-10-02