Incidental Mutation 'R2194:Hif1a'
ID 238302
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Name hypoxia inducible factor 1, alpha subunit
Synonyms bHLHe78, MOP1, HIF-1alpha, HIF1alpha
MMRRC Submission 040196-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2194 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 73948149-73994304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73977521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 183 (N183S)
Ref Sequence ENSEMBL: ENSMUSP00000021530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461] [ENSMUST00000110464]
AlphaFold Q61221
Predicted Effect probably damaging
Transcript: ENSMUST00000021530
AA Change: N183S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: N183S

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110461
AA Change: N171S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: N171S

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110464
AA Change: N183S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106091
Gene: ENSMUSG00000021109
AA Change: N183S

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,773,505 (GRCm39) T275A probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Fkbp5 T C 17: 28,657,001 (GRCm39) D72G probably benign Het
Gm8104 T C 14: 42,959,017 (GRCm39) M69T possibly damaging Het
Greb1 T C 12: 16,740,909 (GRCm39) E1391G probably benign Het
Hnrnpul1 A G 7: 25,425,347 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Ighmbp2 T C 19: 3,315,116 (GRCm39) D768G probably benign Het
Kitl T G 10: 99,851,899 (GRCm39) probably null Het
Mfsd4b4 T A 10: 39,768,919 (GRCm39) N104I probably damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or2t49 T C 11: 58,392,468 (GRCm39) K305E probably damaging Het
Pcdhb4 T C 18: 37,441,788 (GRCm39) V366A probably damaging Het
Polb C T 8: 23,137,483 (GRCm39) R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 22,932,902 (GRCm39) probably benign Het
Rnf40 C A 7: 127,196,407 (GRCm39) A785D probably damaging Het
St7 A G 6: 17,942,718 (GRCm39) E494G probably damaging Het
Tnks1bp1 A G 2: 84,893,409 (GRCm39) E1112G probably benign Het
Zfp607a A G 7: 27,578,805 (GRCm39) E625G possibly damaging Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73,988,784 (GRCm39) missense probably damaging 1.00
IGL01396:Hif1a APN 12 73,987,307 (GRCm39) missense probably benign 0.00
IGL02230:Hif1a APN 12 73,979,224 (GRCm39) missense probably damaging 1.00
IGL02561:Hif1a APN 12 73,988,980 (GRCm39) missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73,977,545 (GRCm39) critical splice donor site probably null
IGL03027:Hif1a APN 12 73,987,251 (GRCm39) missense probably benign 0.03
lightweight UTSW 12 73,988,574 (GRCm39) missense probably damaging 1.00
R0597:Hif1a UTSW 12 73,989,049 (GRCm39) missense probably benign 0.00
R0614:Hif1a UTSW 12 73,992,405 (GRCm39) missense probably damaging 1.00
R0678:Hif1a UTSW 12 73,990,965 (GRCm39) splice site probably null
R0967:Hif1a UTSW 12 73,984,444 (GRCm39) missense possibly damaging 0.91
R1351:Hif1a UTSW 12 73,987,235 (GRCm39) missense probably benign 0.00
R1387:Hif1a UTSW 12 73,989,066 (GRCm39) missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73,990,929 (GRCm39) missense probably benign
R2105:Hif1a UTSW 12 73,984,519 (GRCm39) missense probably damaging 1.00
R4825:Hif1a UTSW 12 73,979,175 (GRCm39) missense probably damaging 1.00
R4924:Hif1a UTSW 12 73,986,331 (GRCm39) missense probably damaging 1.00
R5386:Hif1a UTSW 12 73,990,867 (GRCm39) missense probably benign 0.02
R5594:Hif1a UTSW 12 73,984,566 (GRCm39) nonsense probably null
R5722:Hif1a UTSW 12 73,988,533 (GRCm39) missense probably benign 0.00
R5818:Hif1a UTSW 12 73,986,338 (GRCm39) missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73,988,918 (GRCm39) missense probably benign
R6026:Hif1a UTSW 12 73,979,055 (GRCm39) missense probably damaging 1.00
R6059:Hif1a UTSW 12 73,988,574 (GRCm39) missense probably damaging 1.00
R6084:Hif1a UTSW 12 73,988,616 (GRCm39) missense probably damaging 0.99
R6818:Hif1a UTSW 12 73,992,337 (GRCm39) nonsense probably null
R6878:Hif1a UTSW 12 73,975,055 (GRCm39) missense possibly damaging 0.49
R8028:Hif1a UTSW 12 73,988,801 (GRCm39) missense probably benign 0.27
R8286:Hif1a UTSW 12 73,992,022 (GRCm39) intron probably benign
R8322:Hif1a UTSW 12 73,986,373 (GRCm39) missense probably benign
R8414:Hif1a UTSW 12 73,984,428 (GRCm39) missense probably benign 0.00
R8729:Hif1a UTSW 12 73,990,902 (GRCm39) missense probably damaging 1.00
R9030:Hif1a UTSW 12 73,983,010 (GRCm39) missense probably damaging 1.00
R9087:Hif1a UTSW 12 73,989,099 (GRCm39) missense probably benign 0.01
R9093:Hif1a UTSW 12 73,979,111 (GRCm39) missense probably benign 0.12
R9300:Hif1a UTSW 12 73,987,302 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCTTGCTTTGATGCTCT -3'
(R):5'- CTTTTCCCTCGTAAGTCTATTTTGAAA -3'

Sequencing Primer
(F):5'- TGATGCTCTCATCCTAACAAATTTC -3'
(R):5'- CCTGGAACTTGCTGTGAGGAC -3'
Posted On 2014-10-02