Incidental Mutation 'R2194:Hsp90aa1'
ID238303
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Nameheat shock protein 90, alpha (cytosolic), class A member 1
Synonymshsp4, Hspca, Hsp90, Hsp86-1, Hsp89
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location110690605-110702728 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 110695680 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000121138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
Predicted Effect unknown
Transcript: ENSMUST00000021698
AA Change: M1L
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: M1L

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094361
AA Change: M1L
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: M1L

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124156
AA Change: M1L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270
AA Change: M1L

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145255
Predicted Effect probably benign
Transcript: ENSMUST00000149189
AA Change: M1L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270
AA Change: M1L

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155242
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: M1L

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Meta Mutation Damage Score 0.5676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110694015 unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110695091 missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110693082 missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110695679 start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110692695 missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110692820 missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110695688 splice site probably null
R2039:Hsp90aa1 UTSW 12 110693782 missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110692827 missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110694132 missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110692734 missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2359:Hsp90aa1 UTSW 12 110694569 critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110692753 missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110693406 missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110692321 missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2435:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2925:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3176:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4033:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4815:Hsp90aa1 UTSW 12 110695226 missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110693717 missense probably damaging 1.00
R5117:Hsp90aa1 UTSW 12 110695264 missense possibly damaging 0.71
R5555:Hsp90aa1 UTSW 12 110692734 missense probably damaging 1.00
R6382:Hsp90aa1 UTSW 12 110695517 critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110694112 missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110695225 missense unknown
R7447:Hsp90aa1 UTSW 12 110692128 missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110695294 missense unknown
R7732:Hsp90aa1 UTSW 12 110693418 missense probably damaging 1.00
R8155:Hsp90aa1 UTSW 12 110695394 missense unknown
Z1177:Hsp90aa1 UTSW 12 110693466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTCAGGGAAAGCAACGTC -3'
(R):5'- TGCGCTTCGTAATTACCGC -3'

Sequencing Primer
(F):5'- TTTTCAGGGAAAGCAACGTCCAATC -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'
Posted On2014-10-02