Mutagenetix > Incidental Mutation

Incidental Mutation 'R2194:Hsp90aa1'

238303

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040196-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2194 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 110695680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1 (M1L)

Ref Sequence

ENSEMBL: ENSMUSP00000121138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

unknown
Transcript: ENSMUST00000021698
AA Change: M1L

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000094361
AA Change: M1L

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124156
AA Change: M1L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189
AA Change: M1L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.5676

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdh2	T	C	18: 16,640,448	T275A	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Fkbp5	T	C	17: 28,438,027	D72G	probably benign	Het
Gm8104	T	C	14: 43,101,560	M69T	possibly damaging	Het
Greb1	T	C	12: 16,690,908	E1391G	probably benign	Het
Hif1a	A	G	12: 73,930,747	N183S	probably damaging	Het
Hnrnpul1	A	G	7: 25,725,922		probably null	Het
Ighmbp2	T	C	19: 3,265,116	D768G	probably benign	Het
Kitl	T	G	10: 100,016,037		probably null	Het
Mfsd4b4	T	A	10: 39,892,923	N104I	probably damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr331	T	C	11: 58,501,642	K305E	probably damaging	Het
Pcdhb4	T	C	18: 37,308,735	V366A	probably damaging	Het
Polb	C	T	8: 22,647,467	R89H	probably benign	Het
Rfc4	TTTGTTGTTGTTG	TTTGTTGTTG	16: 23,114,152		probably benign	Het
Rnf40	C	A	7: 127,597,235	A785D	probably damaging	Het
St7	A	G	6: 17,942,719	E494G	probably damaging	Het
Tnks1bp1	A	G	2: 85,063,065	E1112G	probably benign	Het
Zfp607a	A	G	7: 27,879,380	E625G	possibly damaging	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTCAGGGAAAGCAACGTC -3'
(R):5'- TGCGCTTCGTAATTACCGC -3'

Sequencing Primer
(F):5'- TTTTCAGGGAAAGCAACGTCCAATC -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'

Posted On

2014-10-02