Incidental Mutation 'R2194:Gm8104'
ID238305
Institutional Source Beutler Lab
Gene Symbol Gm8104
Ensembl Gene ENSMUSG00000096446
Gene Namepredicted gene 8104
Synonyms
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2194 (G1)
Quality Score83
Status Not validated
Chromosome14
Chromosomal Location43100601-43115190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43101560 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 69 (M69T)
Ref Sequence ENSEMBL: ENSMUSP00000132509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168165
AA Change: M69T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132509
Gene: ENSMUSG00000096446
AA Change: M69T

DomainStartEndE-ValueType
Pfam:Takusan 48 128 2.7e-27 PFAM
coiled coil region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Gm8104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01948:Gm8104 APN 14 43109150 missense probably benign 0.00
FR4548:Gm8104 UTSW 14 43110009 missense probably benign 0.05
FR4548:Gm8104 UTSW 14 43110011 missense probably damaging 0.98
R1800:Gm8104 UTSW 14 43101571 missense possibly damaging 0.75
R4207:Gm8104 UTSW 14 43101634 missense probably damaging 1.00
R5122:Gm8104 UTSW 14 43109093 missense probably benign 0.00
R5230:Gm8104 UTSW 14 43101518 missense probably damaging 0.98
R6339:Gm8104 UTSW 14 43101485 missense probably benign 0.01
R7357:Gm8104 UTSW 14 43101611 missense probably damaging 0.98
R7452:Gm8104 UTSW 14 43110044 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCTCAAATATAGCCTTTCTGC -3'
(R):5'- GTGAGAGATGACACACTCCATTATG -3'

Sequencing Primer
(F):5'- TCAGTGATTAATCCTGTCTCTAGC -3'
(R):5'- CACTCCATTATGAGAGAAAATGTGG -3'
Posted On2014-10-02