Incidental Mutation 'R2194:Rfc4'
ID238306
Institutional Source Beutler Lab
Gene Symbol Rfc4
Ensembl Gene ENSMUSG00000022881
Gene Namereplication factor C (activator 1) 4
SynonymsA1, RFC37
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2194 (G1)
Quality Score217
Status Not validated
Chromosome16
Chromosomal Location23113943-23127737 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TTTGTTGTTGTTG to TTTGTTGTTG at 23114152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023598] [ENSMUST00000023599] [ENSMUST00000077605] [ENSMUST00000115337] [ENSMUST00000115338] [ENSMUST00000115341] [ENSMUST00000123413] [ENSMUST00000131871] [ENSMUST00000133847] [ENSMUST00000147117] [ENSMUST00000168891] [ENSMUST00000187168] [ENSMUST00000232287]
Predicted Effect probably benign
Transcript: ENSMUST00000023598
SMART Domains Protein: ENSMUSP00000023598
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 267 356 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023599
SMART Domains Protein: ENSMUSP00000023599
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 368 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077605
SMART Domains Protein: ENSMUSP00000090876
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083274
Predicted Effect probably benign
Transcript: ENSMUST00000115337
SMART Domains Protein: ENSMUSP00000110994
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
SCOP:d1iqpa2 29 67 2e-5 SMART
PDB:1SXJ|D 39 76 4e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000115338
SMART Domains Protein: ENSMUSP00000110995
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 269 344 3.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115341
SMART Domains Protein: ENSMUSP00000110998
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 53 251 4.62e-58 SMART
HELICc 288 369 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123413
SMART Domains Protein: ENSMUSP00000115649
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130775
Predicted Effect probably benign
Transcript: ENSMUST00000131871
SMART Domains Protein: ENSMUSP00000118141
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 70 2e-33 PDB
Blast:DEXDc 17 73 3e-25 BLAST
SCOP:d1qdea_ 25 71 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133847
SMART Domains Protein: ENSMUSP00000115479
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
Pfam:Rad17 32 97 3.7e-9 PFAM
Pfam:AAA 74 98 2.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144493
Predicted Effect probably benign
Transcript: ENSMUST00000147117
SMART Domains Protein: ENSMUSP00000121745
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 69 4e-33 PDB
Blast:DEXDc 16 72 3e-25 BLAST
SCOP:d1qdea_ 24 70 2e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157310
Predicted Effect probably benign
Transcript: ENSMUST00000168891
SMART Domains Protein: ENSMUSP00000127030
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 1 155 1.92e-14 SMART
HELICc 192 273 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187168
SMART Domains Protein: ENSMUSP00000140809
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197708
Predicted Effect probably benign
Transcript: ENSMUST00000232287
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Rfc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rfc4 APN 16 23115776 missense probably damaging 1.00
IGL01625:Rfc4 APN 16 23115823 missense probably damaging 1.00
IGL02238:Rfc4 APN 16 23114469 missense probably damaging 0.99
IGL02693:Rfc4 APN 16 23114210 missense probably damaging 1.00
R6409_Rfc4_790 UTSW 16 23114073 makesense probably null
R0094:Rfc4 UTSW 16 23115428 missense probably benign 0.03
R0230:Rfc4 UTSW 16 23114099 nonsense probably null
R1493:Rfc4 UTSW 16 23118008 missense probably damaging 1.00
R1699:Rfc4 UTSW 16 23114233 missense probably benign 0.00
R2119:Rfc4 UTSW 16 23124564 missense probably damaging 1.00
R4575:Rfc4 UTSW 16 23114429 unclassified probably benign
R5097:Rfc4 UTSW 16 23114296 missense possibly damaging 0.82
R5495:Rfc4 UTSW 16 23122254 intron probably benign
R6118:Rfc4 UTSW 16 23120943 missense probably damaging 1.00
R6160:Rfc4 UTSW 16 23114683 missense probably damaging 1.00
R6232:Rfc4 UTSW 16 23114090 unclassified probably benign
R6281:Rfc4 UTSW 16 23118066 splice site probably null
R6310:Rfc4 UTSW 16 23114709 missense probably benign 0.37
R6409:Rfc4 UTSW 16 23114073 makesense probably null
R6411:Rfc4 UTSW 16 23114073 makesense probably null
R7161:Rfc4 UTSW 16 23115433 missense probably benign 0.03
R7202:Rfc4 UTSW 16 23127609 start gained probably benign
R7693:Rfc4 UTSW 16 23127413 missense probably damaging 1.00
RF010:Rfc4 UTSW 16 23127482 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACTGGTTTCATACAAAAGGGGAG -3'
(R):5'- GCACTTAACAAGGCAGAGGC -3'

Sequencing Primer
(F):5'- GAGATGAAGCCTCTAACAGTTCTG -3'
(R):5'- GGCCAGGGCAATCTGTAAC -3'
Posted On2014-10-02