Incidental Mutation 'R2194:Fkbp5'
ID238307
Institutional Source Beutler Lab
Gene Symbol Fkbp5
Ensembl Gene ENSMUSG00000024222
Gene NameFK506 binding protein 5
SynonymsFKBP51, D17Ertd592e, Dit1
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28399095-28517524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28438027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000136245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079413] [ENSMUST00000114792] [ENSMUST00000153744] [ENSMUST00000177939]
Predicted Effect probably benign
Transcript: ENSMUST00000079413
AA Change: D72G

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078382
Gene: ENSMUSG00000024222
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114792
AA Change: D72G

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110440
Gene: ENSMUSG00000024222
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153744
AA Change: D72G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116466
Gene: ENSMUSG00000024222
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8e-32 PFAM
internal_repeat_1 138 182 6.75e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000177939
AA Change: D72G

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136245
Gene: ENSMUSG00000024222
AA Change: D72G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8.8e-32 PFAM
Pfam:FKBP_C 158 248 1.8e-15 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It is thought to mediate calcineurin inhibition. It also interacts functionally with mature hetero-oligomeric progesterone receptor complexes along with the 90 kDa heat shock protein and P23 protein. This gene has been found to have multiple polyadenylation sites. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele are normal and fertile. Mice homozygous for another knock-out allele exhibit decreased depression-related behavior and increased anxiety-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Fkbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Fkbp5 APN 17 28401046 utr 3 prime probably benign
IGL03104:Fkbp5 APN 17 28415972 missense probably damaging 1.00
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R0531:Fkbp5 UTSW 17 28438029 missense probably benign 0.00
R1557:Fkbp5 UTSW 17 28402755 missense probably damaging 0.96
R1853:Fkbp5 UTSW 17 28429307 missense possibly damaging 0.82
R2102:Fkbp5 UTSW 17 28406188 missense possibly damaging 0.81
R3522:Fkbp5 UTSW 17 28415996 missense probably benign 0.00
R4959:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R4973:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R5164:Fkbp5 UTSW 17 28437990 critical splice donor site probably null
R6053:Fkbp5 UTSW 17 28428466 missense probably benign 0.00
R6443:Fkbp5 UTSW 17 28429279 missense probably damaging 1.00
R6989:Fkbp5 UTSW 17 28415945 missense probably benign 0.01
R7027:Fkbp5 UTSW 17 28412063 missense probably damaging 1.00
R7454:Fkbp5 UTSW 17 28416025 missense probably damaging 0.97
R7635:Fkbp5 UTSW 17 28428361 missense probably benign 0.00
R7708:Fkbp5 UTSW 17 28438097 missense probably benign
R7862:Fkbp5 UTSW 17 28412039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTTGCCTGGCTTCTC -3'
(R):5'- GAATCTGCCCATCTGTCTGG -3'

Sequencing Primer
(F):5'- CTCTTTGCACATCTATCTCTAGAAC -3'
(R):5'- AGTAGTCCTTGTGGCCTTTGTATCC -3'
Posted On2014-10-02