Incidental Mutation 'R2194:Pcdhb4'
ID238309
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 040196-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37308735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 366 (V366A)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056712
AA Change: V366A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: V366A

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Zfp607a A G 7: 27,879,380 E625G possibly damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 unclassified probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37309549 missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37309614 missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37309240 missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37309296 missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37308664 missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37309400 missense probably damaging 0.99
Z1177:Pcdhb4 UTSW 18 37309913 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATGAAATCACAGGAGAAATCCGTC -3'
(R):5'- TGTGCCCATGTCTGAGACAG -3'

Sequencing Primer
(F):5'- TCCGTCTAAGCAAAAAGTTGGAC -3'
(R):5'- CCCATGTCTGAGACAGTGATG -3'
Posted On2014-10-02