Incidental Mutation 'R2195:Coq10b'
ID 238312
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission 040197-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R2195 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55100457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 47 (L47Q)
Ref Sequence ENSEMBL: ENSMUSP00000027125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027125
AA Change: L47Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: L47Q

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087617
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190239
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 72,991,318 (GRCm39) V540E probably benign Het
Cep295 T A 9: 15,243,617 (GRCm39) Q1613L probably damaging Het
Cib3 A T 8: 72,958,257 (GRCm39) I160N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Impg2 T C 16: 56,080,497 (GRCm39) V767A probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kmt2e T C 5: 23,707,194 (GRCm39) probably null Het
Marf1 T C 16: 13,929,563 (GRCm39) D1681G probably benign Het
Nid1 G T 13: 13,650,788 (GRCm39) V442L probably damaging Het
Or13a21 T C 7: 139,999,138 (GRCm39) T183A possibly damaging Het
Or8k32 T C 2: 86,369,247 (GRCm39) E2G probably benign Het
Ppfia1 T C 7: 144,069,844 (GRCm39) N363S probably damaging Het
Stxbp2 A G 8: 3,684,615 (GRCm39) probably null Het
Tnf A G 17: 35,420,089 (GRCm39) probably null Het
Zkscan7 T C 9: 122,724,686 (GRCm39) F552L possibly damaging Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AACTATACTGCCAGCTGAGGG -3'
(R):5'- CATAGCAGTGTGATCTGTAGAAAG -3'

Sequencing Primer
(F):5'- ATACTGCCAGCTGAGGGTTTTATTTC -3'
(R):5'- TGTGATCTGTAGAAAGAGAGAAAGC -3'
Posted On 2014-10-02