Incidental Mutation 'R2195:Ago2'
ID238326
Institutional Source Beutler Lab
Gene Symbol Ago2
Ensembl Gene ENSMUSG00000036698
Gene Nameargonaute RISC catalytic subunit 2
Synonyms2310051F07Rik, argonaute 2, Eif2c2, 1110029L17Rik
MMRRC Submission 040197-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2195 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location73095844-73184935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73119469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 540 (V540E)
Ref Sequence ENSEMBL: ENSMUSP00000042207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044113]
Predicted Effect probably benign
Transcript: ENSMUST00000044113
AA Change: V540E

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042207
Gene: ENSMUSG00000036698
AA Change: V540E

DomainStartEndE-ValueType
Pfam:ArgoN 29 167 1.7e-29 PFAM
DUF1785 176 228 2.98e-24 SMART
PAZ 236 371 3.11e-4 SMART
Pfam:ArgoL2 376 421 8.7e-16 PFAM
Pfam:ArgoMid 430 512 2.9e-35 PFAM
Piwi 518 819 1.36e-135 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality with neural tube defects, abnormal forebrain patterning, enlarged hearts, pericardial swelling, delayed development, and defects in the yolk sac and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cep295 T A 9: 15,332,321 Q1613L probably damaging Het
Cib3 A T 8: 72,204,413 I160N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Coq10b T A 1: 55,061,298 L47Q probably damaging Het
Impg2 T C 16: 56,260,134 V767A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kmt2e T C 5: 23,502,196 probably null Het
Marf1 T C 16: 14,111,699 D1681G probably benign Het
Nid1 G T 13: 13,476,203 V442L probably damaging Het
Olfr1079 T C 2: 86,538,903 E2G probably benign Het
Olfr532 T C 7: 140,419,225 T183A possibly damaging Het
Ppfia1 T C 7: 144,516,107 N363S probably damaging Het
Stxbp2 A G 8: 3,634,615 probably null Het
Tnf A G 17: 35,201,113 probably null Het
Zkscan7 T C 9: 122,895,621 F552L possibly damaging Het
Other mutations in Ago2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ago2 APN 15 73126453 missense probably benign 0.00
IGL01642:Ago2 APN 15 73123390 missense probably benign 0.00
IGL02017:Ago2 APN 15 73126517 missense probably benign 0.15
IGL02246:Ago2 APN 15 73108418 missense probably damaging 1.00
IGL02434:Ago2 APN 15 73121081 missense probably damaging 1.00
IGL02674:Ago2 APN 15 73111794 missense probably damaging 1.00
IGL02686:Ago2 APN 15 73113742 missense possibly damaging 0.95
IGL02716:Ago2 APN 15 73111727 missense possibly damaging 0.94
IGL02751:Ago2 APN 15 73130897 missense possibly damaging 0.76
IGL02973:Ago2 APN 15 73123465 splice site probably benign
IGL03188:Ago2 APN 15 73123333 missense probably benign
PIT4791001:Ago2 UTSW 15 73121240 missense possibly damaging 0.72
R0316:Ago2 UTSW 15 73130876 missense probably damaging 0.99
R1382:Ago2 UTSW 15 73127040 missense probably benign 0.35
R1509:Ago2 UTSW 15 73116364 missense probably damaging 1.00
R1802:Ago2 UTSW 15 73121180 missense probably damaging 1.00
R1848:Ago2 UTSW 15 73123965 missense probably benign 0.02
R1930:Ago2 UTSW 15 73119355 missense probably damaging 0.97
R2219:Ago2 UTSW 15 73146411 missense probably benign
R2350:Ago2 UTSW 15 73119461 missense probably benign 0.01
R2517:Ago2 UTSW 15 73124242 missense possibly damaging 0.76
R3727:Ago2 UTSW 15 73113857 missense probably damaging 1.00
R4614:Ago2 UTSW 15 73130967 missense probably damaging 0.98
R4667:Ago2 UTSW 15 73146416 missense probably damaging 1.00
R5101:Ago2 UTSW 15 73119490 missense probably damaging 0.99
R5175:Ago2 UTSW 15 73124218 missense possibly damaging 0.57
R5751:Ago2 UTSW 15 73128323 critical splice donor site probably null
R5815:Ago2 UTSW 15 73107366 critical splice acceptor site probably null
R6166:Ago2 UTSW 15 73124240 missense probably benign 0.00
R6378:Ago2 UTSW 15 73123925 missense probably benign
R6572:Ago2 UTSW 15 73126977 missense probably benign 0.14
R6922:Ago2 UTSW 15 73113752 missense probably benign 0.39
R7068:Ago2 UTSW 15 73146450 missense probably damaging 1.00
R7447:Ago2 UTSW 15 73138032 missense probably benign 0.35
R7449:Ago2 UTSW 15 73146499 missense probably damaging 1.00
X0012:Ago2 UTSW 15 73106952 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACTACCAGTGAGCACCTCTC -3'
(R):5'- TAAAGCAGGATTCCGCCAGG -3'

Sequencing Primer
(F):5'- ACTGACCATTTAAGCCAGCTGG -3'
(R):5'- GAGCCCTGCCCCTCTGTC -3'
Posted On2014-10-02