Incidental Mutation 'R2196:Tnn'
ID238334
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission 040198-MU
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R2196 (G1)
Quality Score119
Status Not validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 160097228 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1185 (Y1185*)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably null
Transcript: ENSMUST00000039178
AA Change: Y1449*
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: Y1449*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131919
AA Change: Y1185*
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: Y1185*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCCCTTCAGAGAGCATTG -3'
(R):5'- TGGGAAAGCTCTTTATTAGCAGAG -3'

Sequencing Primer
(F):5'- GCATTGTTAGTGAAGACACCC -3'
(R):5'- CTGTCTCAGATGCAGACAGTG -3'
Posted On2014-10-02