Incidental Mutation 'R2196:Emc1'
ID 238350
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 040198-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R2196 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139093841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 650 (E650D)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: E647D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: E647D

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: E650D

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: E650D

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: E650D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: E650D

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,290,065 (GRCm39) T734S probably damaging Het
Acvr2a A T 2: 48,760,324 (GRCm39) T27S possibly damaging Het
Ankhd1 T A 18: 36,781,432 (GRCm39) N2161K probably damaging Het
Apba3 A G 10: 81,107,542 (GRCm39) Y350C probably damaging Het
Bnipl T A 3: 95,157,181 (GRCm39) R47S possibly damaging Het
Cacna1b C T 2: 24,651,800 (GRCm39) M126I probably damaging Het
Cep112 G A 11: 108,461,187 (GRCm39) E329K probably damaging Het
Cep55 T A 19: 38,057,558 (GRCm39) Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 (GRCm39) I400T possibly damaging Het
Csad T C 15: 102,096,028 (GRCm39) N142D probably benign Het
Dars1 A T 1: 128,306,595 (GRCm39) I195N probably damaging Het
Dmxl1 T A 18: 50,050,698 (GRCm39) L2454Q probably benign Het
Enam A G 5: 88,650,603 (GRCm39) D704G probably damaging Het
Fat1 T A 8: 45,477,683 (GRCm39) I2220N probably damaging Het
Fat4 T C 3: 39,035,566 (GRCm39) S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 (GRCm39) M399T probably benign Het
Gcsh G A 8: 117,715,909 (GRCm39) T58M possibly damaging Het
Ghrhr T C 6: 55,356,726 (GRCm39) Y108H probably damaging Het
Gm5431 A T 11: 48,780,058 (GRCm39) I566N probably damaging Het
Gnb5 A T 9: 75,234,511 (GRCm39) D70V probably damaging Het
Grin2c G T 11: 115,141,492 (GRCm39) S875R probably benign Het
Itch A C 2: 155,044,141 (GRCm39) Q482P probably benign Het
Krt87 T C 15: 101,336,314 (GRCm39) E113G probably damaging Het
Map4 A G 9: 109,900,116 (GRCm39) E934G probably damaging Het
Mkx A G 18: 7,000,675 (GRCm39) L89P probably damaging Het
Myo15a T A 11: 60,400,847 (GRCm39) Y2982* probably null Het
Nedd4 C T 9: 72,632,356 (GRCm39) L397F possibly damaging Het
Nom1 A G 5: 29,641,019 (GRCm39) D353G probably benign Het
Notch1 A T 2: 26,353,816 (GRCm39) L1937* probably null Het
Nrxn2 A T 19: 6,540,139 (GRCm39) D820V probably damaging Het
Nup210 A T 6: 91,032,226 (GRCm39) N47K probably benign Het
Or1j12 T A 2: 36,342,600 (GRCm39) M1K probably null Het
Or4p21 G A 2: 88,277,054 (GRCm39) T76I probably benign Het
Or6d14 A T 6: 116,533,578 (GRCm39) Q64L probably damaging Het
Pcolce2 A T 9: 95,576,742 (GRCm39) I338F probably damaging Het
Pkd1 T C 17: 24,799,046 (GRCm39) M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 106,103,084 (GRCm39) probably benign Het
Rab3a T C 8: 71,209,872 (GRCm39) S51P probably benign Het
Scn10a G A 9: 119,438,070 (GRCm39) A1933V probably benign Het
Serpina1c T A 12: 103,862,370 (GRCm39) Y315F probably damaging Het
Slc29a4 A C 5: 142,698,650 (GRCm39) I104L possibly damaging Het
Spag16 G A 1: 69,897,681 (GRCm39) V144I possibly damaging Het
Spata22 A G 11: 73,236,660 (GRCm39) K322R probably benign Het
Sult2a8 T A 7: 14,161,778 (GRCm39) I23L probably benign Het
Thoc1 T A 18: 9,986,300 (GRCm39) V344D probably damaging Het
Tnn G C 1: 159,924,798 (GRCm39) Y1185* probably null Het
Trpc4 A G 3: 54,209,614 (GRCm39) I660V probably benign Het
Urb1 A G 16: 90,571,144 (GRCm39) Y1222H probably benign Het
Usp4 A G 9: 108,250,885 (GRCm39) E531G probably benign Het
Vmn2r93 C T 17: 18,525,428 (GRCm39) S362L probably damaging Het
Zfhx3 G T 8: 109,526,885 (GRCm39) E927D probably damaging Het
Zfp644 A T 5: 106,786,469 (GRCm39) M1K probably null Het
Zp2 T C 7: 119,737,529 (GRCm39) H252R probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAGGGATTCCTCATGGCTTC -3'
(R):5'- GAGCACCTTATGAAGCCAGG -3'

Sequencing Primer
(F):5'- TCACCTGGAGGACGTGC -3'
(R):5'- CCAGGCGCTCACAAGGG -3'
Posted On 2014-10-02