Incidental Mutation 'R2196:Enam'
ID238352
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88502744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 704 (D704G)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: D629G

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: D629G

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199104
AA Change: D704G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: D704G

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
opinionated UTSW 5 88503026 missense probably benign 0.04
recalcitrant UTSW 5 88503791 nonsense probably null
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
R7282:Enam UTSW 5 88502327 missense probably damaging 0.99
R7365:Enam UTSW 5 88501488 missense possibly damaging 0.75
R7392:Enam UTSW 5 88501664 missense probably damaging 0.99
R7483:Enam UTSW 5 88501820 missense probably damaging 1.00
R7647:Enam UTSW 5 88503025 missense probably benign 0.00
R7648:Enam UTSW 5 88504157 missense possibly damaging 0.89
R7672:Enam UTSW 5 88503971 missense possibly damaging 0.80
R7999:Enam UTSW 5 88503702 missense not run
X0018:Enam UTSW 5 88502691 nonsense probably null
Z1176:Enam UTSW 5 88492971 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGTCACTGTTAGCCACAATATG -3'
(R):5'- TCCAGGTATTTCTTTCAGCAGGG -3'

Sequencing Primer
(F):5'- GTCACTGTTAGCCACAATATGAAAAC -3'
(R):5'- CAGGTATTTCTTTCAGCAGGGAAATG -3'
Posted On2014-10-02