Incidental Mutation 'R2197:C1s2'
ID238410
Institutional Source Beutler Lab
Gene Symbol C1s2
Ensembl Gene ENSMUSG00000079343
Gene Namecomplement component 1, s subcomponent 2
SynonymsGm5077
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124624625-124636085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124632110 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 163 (S163P)
Ref Sequence ENSEMBL: ENSMUSP00000151642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068797] [ENSMUST00000218020]
Predicted Effect probably damaging
Transcript: ENSMUST00000068797
AA Change: S157P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066999
Gene: ENSMUSG00000079343
AA Change: S157P

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204754
AA Change: S163P
SMART Domains Protein: ENSMUSP00000145029
Gene: ENSMUSG00000107554
AA Change: S163P

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218020
AA Change: S163P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in C1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:C1s2 APN 6 124625653 missense probably damaging 0.99
IGL02112:C1s2 APN 6 124625308 missense probably benign 0.28
IGL02342:C1s2 APN 6 124632116 missense probably damaging 0.98
R0616:C1s2 UTSW 6 124628764 missense probably damaging 1.00
R0621:C1s2 UTSW 6 124631112 missense probably damaging 1.00
R1439:C1s2 UTSW 6 124630167 splice site probably benign
R1451:C1s2 UTSW 6 124625494 missense probably benign 0.06
R1484:C1s2 UTSW 6 124625645 missense possibly damaging 0.95
R1570:C1s2 UTSW 6 124625764 missense probably benign 0.01
R1824:C1s2 UTSW 6 124635682 missense probably benign 0.03
R2009:C1s2 UTSW 6 124635089 missense probably damaging 1.00
R2109:C1s2 UTSW 6 124635045 missense probably damaging 0.96
R4421:C1s2 UTSW 6 124625215 missense probably benign 0.39
R4573:C1s2 UTSW 6 124628243 intron probably null
R4906:C1s2 UTSW 6 124635114 nonsense probably null
R4923:C1s2 UTSW 6 124625690 missense probably benign 0.00
R4977:C1s2 UTSW 6 124635639 missense probably damaging 0.96
R5030:C1s2 UTSW 6 124635588 missense possibly damaging 0.77
R5690:C1s2 UTSW 6 124631037 missense probably benign 0.13
R5708:C1s2 UTSW 6 124625743 nonsense probably null
R5846:C1s2 UTSW 6 124631164 missense probably damaging 1.00
R6176:C1s2 UTSW 6 124625809 missense probably damaging 1.00
R6177:C1s2 UTSW 6 124630001 missense probably damaging 0.96
R6842:C1s2 UTSW 6 124627502 missense probably benign 0.12
R7291:C1s2 UTSW 6 124625384 missense probably benign 0.16
R7590:C1s2 UTSW 6 124632128 missense probably damaging 1.00
R7721:C1s2 UTSW 6 124630058 missense possibly damaging 0.73
R7864:C1s2 UTSW 6 124625287 missense probably benign 0.18
R7886:C1s2 UTSW 6 124628330 missense possibly damaging 0.95
R7947:C1s2 UTSW 6 124625287 missense probably benign 0.18
R7969:C1s2 UTSW 6 124628330 missense possibly damaging 0.95
X0062:C1s2 UTSW 6 124635090 missense probably damaging 1.00
Z1177:C1s2 UTSW 6 124625734 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTGAGGATCCTATTCAGTTTGTG -3'
(R):5'- TGGAGAGTATTTAAGCAACAAACC -3'

Sequencing Primer
(F):5'- CAGTTTGTGAACAGCTAACAGC -3'
(R):5'- GTATTTAAGCAACAAACCTTTTCTGG -3'
Posted On2014-10-02