Incidental Mutation 'R2197:Vmn2r57'
ID 238415
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Name vomeronasal 2, receptor 57
Synonyms EG269902
MMRRC Submission 040199-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R2197 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 41049156-41098065 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to G at 41078249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
AlphaFold L7N269
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably null
Transcript: ENSMUST00000165029
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,660,750 (GRCm39) I94F possibly damaging Het
Ankrd50 A T 3: 38,509,741 (GRCm39) D875E probably damaging Het
Arf3 T C 15: 98,639,285 (GRCm39) N60S probably benign Het
Atxn2 T G 5: 121,944,280 (GRCm39) probably null Het
B3gnt8 A T 7: 25,328,373 (GRCm39) I268F probably benign Het
Bmp1 T A 14: 70,723,712 (GRCm39) D708V possibly damaging Het
C1s2 A G 6: 124,609,069 (GRCm39) S163P probably damaging Het
C3 A G 17: 57,526,623 (GRCm39) I786T probably benign Het
Cacna2d2 T A 9: 107,404,602 (GRCm39) L1138Q probably damaging Het
Cage1 T A 13: 38,207,029 (GRCm39) Y272F probably damaging Het
Cd300ld A T 11: 114,875,058 (GRCm39) M192K possibly damaging Het
Cdc5l A T 17: 45,718,745 (GRCm39) F624I probably benign Het
Cdh8 T A 8: 99,922,897 (GRCm39) Q333L probably damaging Het
Ciapin1 T A 8: 95,555,787 (GRCm39) K128* probably null Het
Col6a3 T A 1: 90,731,467 (GRCm39) E988D probably benign Het
Crip3 A G 17: 46,740,338 (GRCm39) E46G probably damaging Het
D5Ertd579e A G 5: 36,772,137 (GRCm39) S753P possibly damaging Het
Dock6 T A 9: 21,744,177 (GRCm39) D126V probably damaging Het
Duxf4 T A 10: 58,072,158 (GRCm39) I19F possibly damaging Het
Dvl3 A G 16: 20,342,506 (GRCm39) E153G probably damaging Het
Epas1 A T 17: 87,136,471 (GRCm39) M748L probably benign Het
Exoc8 A G 8: 125,622,477 (GRCm39) L630P probably damaging Het
Fam227a G A 15: 79,507,668 (GRCm39) T454M probably damaging Het
Flnc A T 6: 29,459,134 (GRCm39) D2472V probably damaging Het
Galnt4 G A 10: 98,944,509 (GRCm39) G78E probably damaging Het
Ghr A T 15: 3,362,956 (GRCm39) L172* probably null Het
Gjb5 A T 4: 127,250,063 (GRCm39) probably null Het
Hdac5 T C 11: 102,095,340 (GRCm39) D427G probably damaging Het
Hsd17b4 G A 18: 50,316,369 (GRCm39) probably null Het
Kcnab1 T C 3: 65,017,368 (GRCm39) I59T probably benign Het
Kcnh7 A G 2: 62,607,950 (GRCm39) Y544H probably damaging Het
Kdm7a A G 6: 39,123,870 (GRCm39) S765P probably damaging Het
Lama1 A T 17: 68,059,936 (GRCm39) H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,814,432 (GRCm39) probably benign Het
Llgl1 T C 11: 60,600,865 (GRCm39) S654P possibly damaging Het
Lvrn G T 18: 47,011,409 (GRCm39) M455I probably benign Het
Mfsd12 T A 10: 81,193,568 (GRCm39) L46Q probably damaging Het
Mtcl1 A T 17: 66,673,427 (GRCm39) M783K probably benign Het
Mthfd1l A T 10: 3,978,399 (GRCm39) T420S probably damaging Het
Mybphl T A 3: 108,284,635 (GRCm39) I294N probably damaging Het
Or4c52 G A 2: 89,845,768 (GRCm39) G165S probably damaging Het
Or4f14b T C 2: 111,775,658 (GRCm39) T48A possibly damaging Het
Or52ab7 T A 7: 102,977,831 (GRCm39) L46* probably null Het
Oxa1l A T 14: 54,598,924 (GRCm39) Q70L probably benign Het
Pcdhac2 A T 18: 37,279,185 (GRCm39) I722F probably damaging Het
Pde4d A G 13: 110,084,924 (GRCm39) D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,556,058 (GRCm39) probably benign Het
Rab11fip3 A G 17: 26,287,152 (GRCm39) S334P probably benign Het
Ror2 C T 13: 53,439,816 (GRCm39) probably null Het
Scnn1g G C 7: 121,366,519 (GRCm39) W572S probably damaging Het
Skint5 G A 4: 113,798,046 (GRCm39) S179L probably damaging Het
Slc22a2 G T 17: 12,817,949 (GRCm39) G175V probably damaging Het
Spaca6 G A 17: 18,056,416 (GRCm39) probably null Het
Tbc1d30 C T 10: 121,140,312 (GRCm39) R207H probably damaging Het
Tdrd5 A G 1: 156,087,435 (GRCm39) I829T probably benign Het
Tmcc3 T C 10: 94,414,780 (GRCm39) S161P probably damaging Het
Tmem150b A G 7: 4,719,353 (GRCm39) V189A probably benign Het
Tmem248 A G 5: 130,260,597 (GRCm39) D54G probably benign Het
Trmt1 T A 8: 85,417,487 (GRCm39) S121T probably damaging Het
Tyk2 C T 9: 21,026,503 (GRCm39) V698M probably damaging Het
Usp17la A G 7: 104,509,919 (GRCm39) R175G probably damaging Het
Vav1 A G 17: 57,610,140 (GRCm39) N464S probably benign Het
Vmn2r78 A G 7: 86,570,535 (GRCm39) Y351C probably damaging Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41,078,209 (GRCm39) missense probably benign
IGL01108:Vmn2r57 APN 7 41,077,008 (GRCm39) missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41,074,467 (GRCm39) missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41,049,370 (GRCm39) missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41,049,619 (GRCm39) missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41,049,874 (GRCm39) missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41,077,650 (GRCm39) missense probably benign
IGL02801:Vmn2r57 APN 7 41,098,056 (GRCm39) missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41,077,498 (GRCm39) missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41,049,165 (GRCm39) missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41,050,076 (GRCm39) missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41,049,157 (GRCm39) splice site probably null
R0305:Vmn2r57 UTSW 7 41,076,967 (GRCm39) missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41,077,216 (GRCm39) missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41,077,216 (GRCm39) missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41,078,225 (GRCm39) missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41,077,228 (GRCm39) missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41,077,635 (GRCm39) missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41,077,254 (GRCm39) missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41,049,548 (GRCm39) missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41,050,067 (GRCm39) missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41,077,531 (GRCm39) missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41,098,001 (GRCm39) missense probably benign 0.00
R2242:Vmn2r57 UTSW 7 41,077,498 (GRCm39) missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41,049,619 (GRCm39) missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41,077,554 (GRCm39) missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41,077,663 (GRCm39) missense probably benign
R4423:Vmn2r57 UTSW 7 41,076,064 (GRCm39) missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41,049,892 (GRCm39) missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41,049,919 (GRCm39) missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41,078,086 (GRCm39) missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41,075,974 (GRCm39) critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41,049,664 (GRCm39) missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41,077,363 (GRCm39) missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41,049,398 (GRCm39) missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41,097,895 (GRCm39) missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41,097,896 (GRCm39) missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41,078,114 (GRCm39) missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41,049,284 (GRCm39) missense probably benign
R6381:Vmn2r57 UTSW 7 41,078,242 (GRCm39) missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41,078,089 (GRCm39) missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41,049,218 (GRCm39) missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41,097,895 (GRCm39) missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41,049,710 (GRCm39) missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41,076,148 (GRCm39) missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41,074,513 (GRCm39) missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41,074,439 (GRCm39) nonsense probably null
R8025:Vmn2r57 UTSW 7 41,076,183 (GRCm39) missense probably benign 0.00
R8332:Vmn2r57 UTSW 7 41,049,677 (GRCm39) missense probably benign 0.01
R8345:Vmn2r57 UTSW 7 41,076,968 (GRCm39) missense possibly damaging 0.81
R8360:Vmn2r57 UTSW 7 41,049,640 (GRCm39) missense probably damaging 1.00
R8738:Vmn2r57 UTSW 7 41,077,020 (GRCm39) missense probably benign 0.00
R8758:Vmn2r57 UTSW 7 41,078,163 (GRCm39) missense probably damaging 1.00
R8955:Vmn2r57 UTSW 7 41,049,571 (GRCm39) missense possibly damaging 0.64
R8985:Vmn2r57 UTSW 7 41,049,259 (GRCm39) missense probably benign
R9108:Vmn2r57 UTSW 7 41,078,192 (GRCm39) missense possibly damaging 0.87
R9160:Vmn2r57 UTSW 7 41,076,159 (GRCm39) missense possibly damaging 0.48
R9354:Vmn2r57 UTSW 7 41,049,663 (GRCm39) missense probably benign 0.01
R9566:Vmn2r57 UTSW 7 41,077,089 (GRCm39) missense probably benign 0.32
R9633:Vmn2r57 UTSW 7 41,076,006 (GRCm39) missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41,077,985 (GRCm39) missense possibly damaging 0.91
X0026:Vmn2r57 UTSW 7 41,077,549 (GRCm39) missense probably benign 0.03
X0065:Vmn2r57 UTSW 7 41,077,395 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41,049,922 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCTGTAAGTGCTGCAGG -3'
(R):5'- ACCTGGGTGACTGGATCAAG -3'

Sequencing Primer
(F):5'- CCTGTAAGTGCTGCAGGTAAATTTC -3'
(R):5'- GGTGACTGGATCAAGATATATTGACC -3'
Posted On 2014-10-02