Incidental Mutation 'R2197:Vmn2r57'
ID 238415
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Name vomeronasal 2, receptor 57
Synonyms EG269902
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R2197 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 41399732-41448641 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to G at 41428825 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
AlphaFold L7N269
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably null
Transcript: ENSMUST00000165029
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
R8025:Vmn2r57 UTSW 7 41426759 missense probably benign 0.00
R8332:Vmn2r57 UTSW 7 41400253 missense probably benign 0.01
R8345:Vmn2r57 UTSW 7 41427544 missense possibly damaging 0.81
R8360:Vmn2r57 UTSW 7 41400216 missense probably damaging 1.00
R8738:Vmn2r57 UTSW 7 41427596 missense probably benign 0.00
R8758:Vmn2r57 UTSW 7 41428739 missense probably damaging 1.00
R8955:Vmn2r57 UTSW 7 41400147 missense possibly damaging 0.64
R8985:Vmn2r57 UTSW 7 41399835 missense probably benign
R9108:Vmn2r57 UTSW 7 41428768 missense possibly damaging 0.87
R9160:Vmn2r57 UTSW 7 41426735 missense possibly damaging 0.48
R9354:Vmn2r57 UTSW 7 41400239 missense probably benign 0.01
R9566:Vmn2r57 UTSW 7 41427665 missense probably benign 0.32
R9633:Vmn2r57 UTSW 7 41426582 missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41400498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCTGTAAGTGCTGCAGG -3'
(R):5'- ACCTGGGTGACTGGATCAAG -3'

Sequencing Primer
(F):5'- CCTGTAAGTGCTGCAGGTAAATTTC -3'
(R):5'- GGTGACTGGATCAAGATATATTGACC -3'
Posted On 2014-10-02