Incidental Mutation 'R2197:Trmt1'
ID238420
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84690858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 121 (S121T)
Ref Sequence ENSEMBL: ENSMUSP00000135540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000001975] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000175784] [ENSMUST00000177084] [ENSMUST00000177423] [ENSMUST00000177531]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
AA Change: S121T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909
AA Change: S121T

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001975
SMART Domains Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910

DomainStartEndE-ValueType
BTB 30 124 4.05e-25 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
BEN 382 457 6.4e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077990
Predicted Effect probably benign
Transcript: ENSMUST00000109767
AA Change: S121T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909
AA Change: S121T

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109768
AA Change: S114T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: S114T

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125370
AA Change: S121T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909
AA Change: S121T

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128537
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137953
Predicted Effect probably benign
Transcript: ENSMUST00000143427
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150085
Predicted Effect possibly damaging
Transcript: ENSMUST00000152301
AA Change: S124T

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909
AA Change: S124T

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175784
AA Change: S124T

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135273
Gene: ENSMUSG00000001909
AA Change: S124T

DomainStartEndE-ValueType
Pfam:TRM 54 221 8.6e-39 PFAM
Pfam:Met_10 144 221 5.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176914
Predicted Effect probably benign
Transcript: ENSMUST00000177084
AA Change: S96T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909
AA Change: S96T

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177364
Predicted Effect possibly damaging
Transcript: ENSMUST00000177423
AA Change: S117T

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909
AA Change: S117T

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177531
AA Change: S121T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135540
Gene: ENSMUSG00000001909
AA Change: S121T

DomainStartEndE-ValueType
Pfam:TRM 54 174 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 unclassified probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
PIT4418001:Trmt1 UTSW 8 84697670 missense probably damaging 0.97
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6299:Trmt1 UTSW 8 84697290 nonsense probably null
R6614:Trmt1 UTSW 8 84689333 missense probably benign
R6666:Trmt1 UTSW 8 84698454 missense probably damaging 1.00
R7669:Trmt1 UTSW 8 84697551 missense probably benign 0.05
Z1176:Trmt1 UTSW 8 84698240 missense possibly damaging 0.95
Z1176:Trmt1 UTSW 8 84699198 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTTCCTGAAAGCTCTAGGC -3'
(R):5'- TGCTTTCCCAGGGAGCTATC -3'

Sequencing Primer
(F):5'- CTTTCTGCCTTTCTCCTGGGGG -3'
(R):5'- GGAGCTATCCCTCTGACTGATG -3'
Posted On2014-10-02