Incidental Mutation 'R2197:Ciapin1'
ID238421
Institutional Source Beutler Lab
Gene Symbol Ciapin1
Ensembl Gene ENSMUSG00000031781
Gene Namecytokine induced apoptosis inhibitor 1
Synonymsanamorsin, 2810413N20Rik
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94819804-94838358 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 94829159 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 128 (K128*)
Ref Sequence ENSEMBL: ENSMUSP00000125451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034233] [ENSMUST00000161792] [ENSMUST00000162538]
Predicted Effect probably null
Transcript: ENSMUST00000034233
AA Change: K128*
SMART Domains Protein: ENSMUSP00000034233
Gene: ENSMUSG00000031781
AA Change: K128*

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160898
Predicted Effect probably null
Transcript: ENSMUST00000161762
AA Change: K54*
SMART Domains Protein: ENSMUSP00000123794
Gene: ENSMUSG00000031781
AA Change: K54*

DomainStartEndE-ValueType
PDB:2LD4|A 1 171 9e-95 PDB
SCOP:d1khha_ 8 146 2e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161792
AA Change: K73*
SMART Domains Protein: ENSMUSP00000125474
Gene: ENSMUSG00000031781
AA Change: K73*

DomainStartEndE-ValueType
PDB:2LD4|A 10 76 3e-31 PDB
Pfam:CIAPIN1 125 158 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162357
Predicted Effect probably null
Transcript: ENSMUST00000162538
AA Change: K128*
SMART Domains Protein: ENSMUSP00000125451
Gene: ENSMUSG00000031781
AA Change: K128*

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 (MIM 151430) or CASP (see MIM 147678) families. Expression of CIAPIN1 is dependent on growth factor stimulation (Shibayama et al., 2004 [PubMed 14970183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with erythropoietic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Ciapin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Ciapin1 UTSW 8 94825219 missense possibly damaging 0.91
R0070:Ciapin1 UTSW 8 94825219 missense possibly damaging 0.91
R0218:Ciapin1 UTSW 8 94828310 missense probably damaging 0.98
R1980:Ciapin1 UTSW 8 94832533 missense probably benign 0.00
R2273:Ciapin1 UTSW 8 94831787 missense probably damaging 0.98
R4020:Ciapin1 UTSW 8 94829186 missense probably damaging 1.00
R5790:Ciapin1 UTSW 8 94825183 intron probably benign
R7236:Ciapin1 UTSW 8 94823710 missense
Predicted Primers PCR Primer
(F):5'- AGCTCTAGGAAGACCAGTGC -3'
(R):5'- ATCTAACATTCTTTGGGAGGGG -3'

Sequencing Primer
(F):5'- CGAGTCTTCAGAAGGAACCTGTTC -3'
(R):5'- CCAGAGGTCTTGAATTCAATTCCCAG -3'
Posted On2014-10-02