Incidental Mutation 'R2197:Exoc8'
ID238424
Institutional Source Beutler Lab
Gene Symbol Exoc8
Ensembl Gene ENSMUSG00000074030
Gene Nameexocyst complex component 8
SynonymsSEC84, EXO84, Exo84p
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124893108-124897705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124895738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 630 (L630P)
Ref Sequence ENSEMBL: ENSMUSP00000095915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably benign
Transcript: ENSMUST00000034467
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098312
AA Change: L630P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030
AA Change: L630P

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213052
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the exocyst complex, an evolutionarily conserved multi-protein complex that plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. This protein is a target of activated Ral subfamily of GTPases and thereby regulates exocytosis by tethering vesicles to the plasma membrane. Mutations in this gene may be related to Joubert syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Exoc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Exoc8 APN 8 124896872 missense probably damaging 1.00
IGL01444:Exoc8 APN 8 124895841 missense possibly damaging 0.84
IGL01655:Exoc8 APN 8 124896228 missense probably benign 0.03
IGL01881:Exoc8 APN 8 124896351 missense probably damaging 1.00
IGL02952:Exoc8 APN 8 124897536 missense probably benign 0.02
R0683:Exoc8 UTSW 8 124895633 missense probably damaging 0.99
R2051:Exoc8 UTSW 8 124895480 missense probably benign 0.15
R2140:Exoc8 UTSW 8 124897415 missense possibly damaging 0.84
R2209:Exoc8 UTSW 8 124896179 nonsense probably null
R4659:Exoc8 UTSW 8 124897532 missense probably damaging 1.00
R4707:Exoc8 UTSW 8 124897470 missense possibly damaging 0.93
R4724:Exoc8 UTSW 8 124897250 missense probably benign
R4764:Exoc8 UTSW 8 124897575 missense possibly damaging 0.94
R5159:Exoc8 UTSW 8 124896213 missense probably benign 0.00
R5976:Exoc8 UTSW 8 124896653 missense probably benign 0.02
R6566:Exoc8 UTSW 8 124896044 missense probably damaging 1.00
R6602:Exoc8 UTSW 8 124896411 missense probably damaging 1.00
R7246:Exoc8 UTSW 8 124896417 nonsense probably null
R7341:Exoc8 UTSW 8 124896581 missense probably damaging 1.00
R7440:Exoc8 UTSW 8 124895781 missense probably benign
R7745:Exoc8 UTSW 8 124895819 missense probably benign
Z1176:Exoc8 UTSW 8 124896666 missense not run
Z1177:Exoc8 UTSW 8 124897186 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTCGTGCTCTCGGGATTC -3'
(R):5'- TGAACCTGATGACTCCTGAGG -3'

Sequencing Primer
(F):5'- AGGTCCTGCAGCTGCTTG -3'
(R):5'- TGATGACTCCTGAGGCCCTG -3'
Posted On2014-10-02