Incidental Mutation 'R2197:Tyk2'
ID238425
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21115207 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 698 (V698M)
Ref Sequence ENSEMBL: ENSMUSP00000150354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]
Predicted Effect probably damaging
Transcript: ENSMUST00000001036
AA Change: V698M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: V698M

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213717
Predicted Effect probably damaging
Transcript: ENSMUST00000214454
AA Change: V675M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216874
AA Change: V698M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R3622:Tyk2 UTSW 9 21127310 missense probably damaging 0.98
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5305:Tyk2 UTSW 9 21109381 missense probably damaging 0.99
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6610:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7218:Tyk2 UTSW 9 21105054 missense probably damaging 1.00
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7322:Tyk2 UTSW 9 21110204 missense probably benign
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
R7759:Tyk2 UTSW 9 21120258 critical splice donor site probably null
R7840:Tyk2 UTSW 9 21124967 missense probably damaging 1.00
R7854:Tyk2 UTSW 9 21115480 missense probably benign
R7923:Tyk2 UTSW 9 21124967 missense probably damaging 1.00
R7937:Tyk2 UTSW 9 21115480 missense probably benign
Z1177:Tyk2 UTSW 9 21105367 missense probably benign
Z1177:Tyk2 UTSW 9 21108875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAGGAGAGATTGATGGTC -3'
(R):5'- TGCTCAAAGTTCTCGACCCC -3'

Sequencing Primer
(F):5'- CCTGGGGATGTAGCTCAAC -3'
(R):5'- AGTCACCATGATATCGCCTTGG -3'
Posted On2014-10-02