Incidental Mutation 'R2197:Adam11'
ID238442
Institutional Source Beutler Lab
Gene Symbol Adam11
Ensembl Gene ENSMUSG00000020926
Gene Namea disintegrin and metallopeptidase domain 11
SynonymsMdc
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102761439-102780262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102769924 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 94 (I94F)
Ref Sequence ENSEMBL: ENSMUSP00000099370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068150] [ENSMUST00000103081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068150
AA Change: I94F

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069466
Gene: ENSMUSG00000020926
AA Change: I94F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 50 193 5.7e-29 PFAM
Pfam:Reprolysin_5 241 390 2.1e-9 PFAM
Pfam:Reprolysin 243 442 1.1e-68 PFAM
Pfam:Reprolysin_3 267 378 1.3e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103081
AA Change: I94F

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099370
Gene: ENSMUSG00000020926
AA Change: I94F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 193 1.1e-28 PFAM
Pfam:Reprolysin_5 241 390 2.3e-9 PFAM
Pfam:Reprolysin 243 442 5.3e-62 PFAM
Pfam:Reprolysin_3 267 385 4.5e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit defects in spatial learning, motor coordination and altered perception of pain. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and overtly normal but show impaired hippocampus-dependent spatial learning and cerebellum-dependent motor coordination when tested using water maze and rotating rod tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Adam11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adam11 APN 11 102776831 missense probably benign 0.40
IGL00497:Adam11 APN 11 102770147 missense probably damaging 1.00
IGL00570:Adam11 APN 11 102776350 missense possibly damaging 0.76
IGL01875:Adam11 APN 11 102772856 missense probably damaging 1.00
IGL01945:Adam11 APN 11 102772910 missense probably damaging 0.99
IGL02266:Adam11 APN 11 102772667 missense probably damaging 1.00
IGL02702:Adam11 APN 11 102777038 missense probably benign 0.26
IGL03395:Adam11 APN 11 102772920 missense probably damaging 1.00
R0091:Adam11 UTSW 11 102772839 missense probably damaging 1.00
R0135:Adam11 UTSW 11 102776573 missense probably damaging 1.00
R1068:Adam11 UTSW 11 102776378 missense probably damaging 1.00
R1529:Adam11 UTSW 11 102775113 critical splice donor site probably null
R2357:Adam11 UTSW 11 102774508 missense probably benign
R3082:Adam11 UTSW 11 102770117 splice site probably benign
R3784:Adam11 UTSW 11 102774367 critical splice donor site probably null
R5254:Adam11 UTSW 11 102774272 nonsense probably null
R5367:Adam11 UTSW 11 102773653 missense probably benign 0.00
R5444:Adam11 UTSW 11 102772848 missense probably damaging 1.00
R5699:Adam11 UTSW 11 102773640 missense probably benign 0.00
R5881:Adam11 UTSW 11 102773810 missense probably benign 0.17
R6193:Adam11 UTSW 11 102771261 missense probably benign
R6422:Adam11 UTSW 11 102774283 missense possibly damaging 0.95
R6798:Adam11 UTSW 11 102777008 missense probably damaging 1.00
R6822:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
R7173:Adam11 UTSW 11 102771931 missense possibly damaging 0.93
R7207:Adam11 UTSW 11 102772057 missense probably benign 0.03
R7719:Adam11 UTSW 11 102772477 missense probably benign 0.01
X0023:Adam11 UTSW 11 102774630 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTGAACAAACAGCTCTCCCTG -3'
(R):5'- TCCACATACTGCGAGGACAG -3'

Sequencing Primer
(F):5'- AACAGCTCTCCCTGGGAAAGG -3'
(R):5'- GTGACTGAAATCGCAAAGTAGC -3'
Posted On2014-10-02