Incidental Mutation 'R2197:Cd300ld'
ID238443
Institutional Source Beutler Lab
Gene Symbol Cd300ld
Ensembl Gene ENSMUSG00000034641
Gene NameCD300 molecule like family member d
SynonymsMAIR-IV, Clm5, 4732429D16Rik
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114982274-114989922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114984232 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 192 (M192K)
Ref Sequence ENSEMBL: ENSMUSP00000047022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045075
AA Change: M192K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047022
Gene: ENSMUSG00000034641
AA Change: M192K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 8.85e-5 SMART
transmembrane domain 176 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Cd300ld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Cd300ld APN 11 114986173 missense probably benign
IGL01976:Cd300ld APN 11 114987444 missense probably damaging 1.00
IGL02019:Cd300ld APN 11 114987401 missense probably damaging 1.00
IGL02738:Cd300ld APN 11 114984250 missense probably benign 0.40
IGL03386:Cd300ld APN 11 114984172 missense probably benign
R2001:Cd300ld UTSW 11 114987330 missense probably benign 0.44
R3039:Cd300ld UTSW 11 114986177 missense probably benign
R5540:Cd300ld UTSW 11 114987405 missense probably damaging 1.00
R7096:Cd300ld UTSW 11 114987495 missense possibly damaging 0.92
R7371:Cd300ld UTSW 11 114987360 missense probably damaging 1.00
R7548:Cd300ld UTSW 11 114987422 missense probably benign 0.02
R7710:Cd300ld UTSW 11 114984212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCATGGTACTGCTGATGAG -3'
(R):5'- AGGCTTGACTTTATCTGGCC -3'

Sequencing Primer
(F):5'- CCCTGTCTCAGATACTAAGGGAATG -3'
(R):5'- CTTGACTTTATCTGGCCTTGAAG -3'
Posted On2014-10-02