Incidental Mutation 'R2197:Cage1'
ID238444
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Namecancer antigen 1
SynonymsCtag3, 4933427I01Rik, CAGE1
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38006052-38037069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38023053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 272 (Y272F)
Ref Sequence ENSEMBL: ENSMUSP00000087278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: Y378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: Y378F

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089840
AA Change: Y272F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566
AA Change: Y272F

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: Y378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: Y378F

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131066
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38022993 nonsense probably null
IGL01736:Cage1 APN 13 38022813 missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38022529 missense probably damaging 1.00
IGL02267:Cage1 APN 13 38023257 missense probably damaging 1.00
IGL03030:Cage1 APN 13 38028147 missense probably benign
IGL03216:Cage1 APN 13 38006177 splice site probably benign
R0487:Cage1 UTSW 13 38025358 missense probably benign 0.00
R0606:Cage1 UTSW 13 38016494 splice site probably benign
R1015:Cage1 UTSW 13 38016475 missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38022880 missense probably damaging 1.00
R1400:Cage1 UTSW 13 38032424 missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38023333 nonsense probably null
R2057:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2058:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2059:Cage1 UTSW 13 38023380 missense probably benign 0.04
R3757:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38019177 missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38025650 missense probably damaging 1.00
R4401:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4402:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4403:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4490:Cage1 UTSW 13 38023417 missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38025501 missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38019208 missense probably benign 0.33
R4950:Cage1 UTSW 13 38023326 missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38023430 missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38011411 nonsense probably null
R5808:Cage1 UTSW 13 38022325 unclassified probably benign
R5845:Cage1 UTSW 13 38015706 missense probably damaging 0.96
R6278:Cage1 UTSW 13 38016419 missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38025449 missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38022558 missense probably damaging 1.00
R7146:Cage1 UTSW 13 38023049 missense probably benign 0.03
R7192:Cage1 UTSW 13 38019244 missense probably benign
R7529:Cage1 UTSW 13 38025755 missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38022724 missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38022847 missense probably damaging 1.00
R7837:Cage1 UTSW 13 38022405 missense not run
R7920:Cage1 UTSW 13 38022405 missense not run
Predicted Primers PCR Primer
(F):5'- CAATATACCTTTCCTGTAAGCGC -3'
(R):5'- CAGCTGTGAAGGCTTAGAGC -3'

Sequencing Primer
(F):5'- TCCTGTAAGCGCACGTAATG -3'
(R):5'- GCTTAGAGCCTCTGGAAGAG -3'
Posted On2014-10-02