Incidental Mutation 'R2197:Ror2'
ID238445
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2197 (G1)
Quality Score93
Status Not validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 53285780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably null
Transcript: ENSMUST00000021918
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACTTAGTGGTCCCTAGAGC -3'
(R):5'- TGCAGTGAATCGGTGCATCG -3'

Sequencing Primer
(F):5'- CGCAGCTCATTGGAACCAG -3'
(R):5'- ACCAGAGTGGCCCTCGAAG -3'
Posted On2014-10-02