Incidental Mutation 'R2197:Dvl3'
ID238453
Institutional Source Beutler Lab
Gene Symbol Dvl3
Ensembl Gene ENSMUSG00000003233
Gene Namedishevelled segment polarity protein 3
Synonyms
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20516982-20534010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20523756 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 153 (E153G)
Ref Sequence ENSEMBL: ENSMUSP00000126082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003318] [ENSMUST00000171572] [ENSMUST00000171774]
Predicted Effect probably damaging
Transcript: ENSMUST00000003318
AA Change: E153G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003318
Gene: ENSMUSG00000003233
AA Change: E153G

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 1.6e-36 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 5.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169552
Predicted Effect probably benign
Transcript: ENSMUST00000171572
AA Change: E153G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130925
Gene: ENSMUSG00000003233
AA Change: E153G

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 89 245 1.3e-63 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 1.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171774
AA Change: E153G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126082
Gene: ENSMUSG00000003233
AA Change: E153G

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 3.9e-37 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 361 379 N/A INTRINSIC
DEP 405 479 3.43e-27 SMART
Pfam:Dsh_C 483 689 1.8e-88 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a multi-gene family which shares strong similarity with the Drosophila dishevelled gene, dsh. The Drosophila dishevelled gene encodes a cytoplasmic phosphoprotein that regulates cell proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with respiratory distress, persistent truncus arteriosis, and double outlet right ventricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Dvl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Dvl3 APN 16 20530939 missense probably damaging 0.97
IGL02318:Dvl3 APN 16 20523743 missense possibly damaging 0.52
R0490:Dvl3 UTSW 16 20527423 splice site probably benign
R0491:Dvl3 UTSW 16 20527423 splice site probably benign
R1356:Dvl3 UTSW 16 20524305 small deletion probably benign
R1502:Dvl3 UTSW 16 20523459 missense probably damaging 0.99
R2062:Dvl3 UTSW 16 20526351 missense probably benign 0.33
R4232:Dvl3 UTSW 16 20524233 intron probably benign
R4346:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4347:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4350:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4351:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4352:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R5129:Dvl3 UTSW 16 20517340 missense possibly damaging 0.95
R5134:Dvl3 UTSW 16 20524607 intron probably benign
R5430:Dvl3 UTSW 16 20523731 missense probably damaging 1.00
R5586:Dvl3 UTSW 16 20517289 missense probably damaging 0.98
R5643:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5644:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5961:Dvl3 UTSW 16 20530979 missense possibly damaging 0.86
R6143:Dvl3 UTSW 16 20527039 missense possibly damaging 0.92
R6502:Dvl3 UTSW 16 20527383 missense probably damaging 1.00
R7117:Dvl3 UTSW 16 20527322 nonsense probably null
R7740:Dvl3 UTSW 16 20527250 critical splice acceptor site probably null
X0062:Dvl3 UTSW 16 20523495 missense probably damaging 1.00
Z1176:Dvl3 UTSW 16 20530881 missense probably damaging 0.97
Z1177:Dvl3 UTSW 16 20517088 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGCAGCTCAGTTCAAC -3'
(R):5'- ACCCTTTGTGGTTCCATTGAG -3'

Sequencing Primer
(F):5'- TCAGTTCAACCCAGGGCTG -3'
(R):5'- TCCATTGAGTCGGGCTGC -3'
Posted On2014-10-02