Incidental Mutation 'R2197:Rab11fip3'
ID238457
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26068178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 334 (S334P)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]
Predicted Effect probably benign
Transcript: ENSMUST00000120691
AA Change: S334P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: S334P

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122103
AA Change: S334P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: S334P

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126306
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense probably damaging 0.97
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26068891 missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26069054 missense probably benign 0.33
R2382:Rab11fip3 UTSW 17 25990867 nonsense probably null
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26016064 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26016116 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26068152 missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26068874 missense possibly damaging 0.66
R7836:Rab11fip3 UTSW 17 26068258 missense possibly damaging 0.82
R7919:Rab11fip3 UTSW 17 26068258 missense possibly damaging 0.82
R8008:Rab11fip3 UTSW 17 26067982 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACATCGTGATGGATCGGGC -3'
(R):5'- CACTTAGCCAAAGAGCTGGAG -3'

Sequencing Primer
(F):5'- GCTCGTCTGGTTCATTGGCC -3'
(R):5'- CTGTCTCTTGGCCAAAAAGTG -3'
Posted On2014-10-02