Incidental Mutation 'R2198:Cdh20'
List |< first << previous [record 9 of 58] next >> last >|
ID238471
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Namecadherin 20
SynonymsCdh7
MMRRC Submission 040200-MU
Accession Numbers

Genbank: NM_011800

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location104768529-104995481 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 104947322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
Predicted Effect probably null
Transcript: ENSMUST00000062528
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104953887 missense probably benign 0.05
IGL00743:Cdh20 APN 1 104947428 missense probably benign 0.06
IGL00848:Cdh20 APN 1 104934256 missense probably benign
IGL01393:Cdh20 APN 1 104934244 missense probably benign
IGL01396:Cdh20 APN 1 104947429 missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104934107 missense probably benign 0.05
IGL01612:Cdh20 APN 1 104994170 missense probably benign 0.02
IGL01947:Cdh20 APN 1 104993924 missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104941037 missense probably damaging 1.00
IGL02226:Cdh20 APN 1 104954091 splice site probably benign
IGL02318:Cdh20 APN 1 104954039 missense probably null 0.03
IGL02326:Cdh20 APN 1 104975039 missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104947465 missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104934098 start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104941257 missense probably damaging 1.00
3-1:Cdh20 UTSW 1 104947420 missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
IGL02991:Cdh20 UTSW 1 104934247 missense probably benign
R0178:Cdh20 UTSW 1 104975051 missense possibly damaging 0.82
R1114:Cdh20 UTSW 1 104979014 missense probably damaging 0.96
R1401:Cdh20 UTSW 1 104947497 missense possibly damaging 0.65
R1502:Cdh20 UTSW 1 104954030 missense probably benign 0.06
R1764:Cdh20 UTSW 1 104934345 splice site probably benign
R2279:Cdh20 UTSW 1 104947414 missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104975015 missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104947474 missense probably damaging 1.00
R4243:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4349:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104934310 missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104984685 missense probably damaging 0.99
R4795:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104984803 missense probably damaging 1.00
R5056:Cdh20 UTSW 1 104953997 missense probably benign 0.00
R5127:Cdh20 UTSW 1 104947348 missense probably damaging 1.00
R5269:Cdh20 UTSW 1 104934157 missense possibly damaging 0.67
R5563:Cdh20 UTSW 1 104947357 missense probably benign 0.29
R5634:Cdh20 UTSW 1 104975075 missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104984910 missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104934098 start codon destroyed probably null 0.49
R5933:Cdh20 UTSW 1 104984671 missense probably damaging 1.00
R6109:Cdh20 UTSW 1 104994014 missense probably damaging 1.00
R6521:Cdh20 UTSW 1 104942134 missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104984686 missense possibly damaging 0.95
R7169:Cdh20 UTSW 1 104947353 missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104993977 missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104954071 missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104970873 missense probably benign
R7535:Cdh20 UTSW 1 104975043 missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104941279 missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104941299 missense probably damaging 1.00
R7879:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R7925:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
R8257:Cdh20 UTSW 1 104994237 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTGCTTCTCACTACTCTGAAGG -3'
(R):5'- TGCCAACTTGGAAGTTTTGGTC -3'

Sequencing Primer
(F):5'- ACCTGCCTTATTCTTTAGGTTCAGAG -3'
(R):5'- AGGTCCTTGGCAAACACT -3'
Posted On2014-10-02