Incidental Mutation 'R2198:Shc4'
ID238477
Institutional Source Beutler Lab
Gene Symbol Shc4
Ensembl Gene ENSMUSG00000035109
Gene NameSHC (Src homology 2 domain containing) family, member 4
Synonyms9930029B02Rik, LOC271849, 6230417E10Rik
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125627447-125724148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125639346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 548 (V548E)
Ref Sequence ENSEMBL: ENSMUSP00000043146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042246] [ENSMUST00000110477] [ENSMUST00000110480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042246
AA Change: V548E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043146
Gene: ENSMUSG00000035109
AA Change: V548E

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
PTB 187 351 1.38e-34 SMART
SH2 520 599 4.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110477
AA Change: V262E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106103
Gene: ENSMUSG00000035109
AA Change: V262E

DomainStartEndE-ValueType
Pfam:PID 1 62 1.7e-19 PFAM
SH2 234 313 4.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110480
AA Change: V262E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106106
Gene: ENSMUSG00000035109
AA Change: V262E

DomainStartEndE-ValueType
Pfam:PID 1 62 1.7e-19 PFAM
SH2 234 313 4.69e-24 SMART
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Shc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Shc4 APN 2 125649154 missense probably damaging 0.96
IGL03003:Shc4 APN 2 125723333 nonsense probably null
R0167:Shc4 UTSW 2 125723013 missense probably benign 0.00
R0784:Shc4 UTSW 2 125657496 missense probably benign 0.08
R0959:Shc4 UTSW 2 125678687 critical splice donor site probably null
R1099:Shc4 UTSW 2 125722844 missense probably benign 0.03
R1864:Shc4 UTSW 2 125639367 missense probably damaging 1.00
R3791:Shc4 UTSW 2 125723331 missense probably damaging 0.97
R4324:Shc4 UTSW 2 125678750 missense probably benign 0.23
R4424:Shc4 UTSW 2 125652522 missense probably benign
R4611:Shc4 UTSW 2 125655682 missense probably benign 0.29
R4745:Shc4 UTSW 2 125649277 missense probably damaging 0.96
R5037:Shc4 UTSW 2 125629727 missense probably damaging 1.00
R5433:Shc4 UTSW 2 125639430 missense probably damaging 1.00
R5754:Shc4 UTSW 2 125670298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATATGGTTCCAGAAGACG -3'
(R):5'- CGGACTGACGAGGTGATAACTC -3'

Sequencing Primer
(F):5'- GTTCCAGAAGACGTTAGCACTTAGC -3'
(R):5'- ACGAGGTGATAACTCTGTGATGTCTC -3'
Posted On2014-10-02