Incidental Mutation 'R2198:4932431P20Rik'
ID238488
Institutional Source Beutler Lab
Gene Symbol 4932431P20Rik
Ensembl Gene ENSMUSG00000074224
Gene NameRIKEN cDNA 4932431P20 gene
Synonyms
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29519205-29538057 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 29527272 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141713
SMART Domains Protein: ENSMUSP00000120285
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
Blast:WD40 94 134 1e-9 BLAST
WD40 139 176 1.59e1 SMART
WD40 228 269 9.51e1 SMART
WD40 272 311 3.33e-1 SMART
Blast:WD40 354 393 4e-15 BLAST
Blast:WD40 445 490 2e-22 BLAST
Blast:WD40 493 538 8e-15 BLAST
WD40 595 634 1.68e-6 SMART
low complexity region 701 710 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
coiled coil region 1135 1168 N/A INTRINSIC
low complexity region 1211 1230 N/A INTRINSIC
low complexity region 1239 1273 N/A INTRINSIC
coiled coil region 1347 1375 N/A INTRINSIC
coiled coil region 1399 1433 N/A INTRINSIC
low complexity region 1435 1453 N/A INTRINSIC
low complexity region 1497 1519 N/A INTRINSIC
coiled coil region 1612 1707 N/A INTRINSIC
coiled coil region 1731 1989 N/A INTRINSIC
coiled coil region 2034 2072 N/A INTRINSIC
coiled coil region 2127 2154 N/A INTRINSIC
coiled coil region 2220 2302 N/A INTRINSIC
coiled coil region 2357 2561 N/A INTRINSIC
low complexity region 2993 2999 N/A INTRINSIC
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in 4932431P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:4932431P20Rik APN 7 29537622 exon noncoding transcript
IGL00505:4932431P20Rik APN 7 29534183 exon noncoding transcript
IGL00557:4932431P20Rik APN 7 29535802 exon noncoding transcript
IGL00569:4932431P20Rik APN 7 29534140 exon noncoding transcript
IGL00966:4932431P20Rik APN 7 29537463 exon noncoding transcript
IGL01668:4932431P20Rik APN 7 29537430 exon noncoding transcript
K7371:4932431P20Rik UTSW 7 29530992 exon noncoding transcript
P0037:4932431P20Rik UTSW 7 29533614 exon noncoding transcript
R0179:4932431P20Rik UTSW 7 29535940 exon noncoding transcript
R0357:4932431P20Rik UTSW 7 29535582 exon noncoding transcript
R0358:4932431P20Rik UTSW 7 29532211 exon noncoding transcript
R0412:4932431P20Rik UTSW 7 29530570 exon noncoding transcript
R0530:4932431P20Rik UTSW 7 29530120 exon noncoding transcript
R0600:4932431P20Rik UTSW 7 29533265 exon noncoding transcript
R0675:4932431P20Rik UTSW 7 29532517 exon noncoding transcript
R1118:4932431P20Rik UTSW 7 29534244 exon noncoding transcript
R1395:4932431P20Rik UTSW 7 29531387 exon noncoding transcript
R1444:4932431P20Rik UTSW 7 29529955 exon noncoding transcript
R1476:4932431P20Rik UTSW 7 29534890 exon noncoding transcript
R1534:4932431P20Rik UTSW 7 29530429 exon noncoding transcript
R1535:4932431P20Rik UTSW 7 29529579 exon noncoding transcript
R2023:4932431P20Rik UTSW 7 29531534 exon noncoding transcript
R2127:4932431P20Rik UTSW 7 29537140 exon noncoding transcript
R2141:4932431P20Rik UTSW 7 29531510 exon noncoding transcript
R2201:4932431P20Rik UTSW 7 29536525 exon noncoding transcript
R2262:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R2263:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R4874:4932431P20Rik UTSW 7 29536183 exon noncoding transcript
R5064:4932431P20Rik UTSW 7 29535655 exon noncoding transcript
R5130:4932431P20Rik UTSW 7 29529274 exon noncoding transcript
R5366:4932431P20Rik UTSW 7 29533539 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGCTCCCTCTGACAGACAG -3'
(R):5'- TTCAGAGCTACAAGGGTGTG -3'

Sequencing Primer
(F):5'- CTCCAGGTGTGTAAAGTTGACAACC -3'
(R):5'- CCTTTGGGGGAACTGAGAAG -3'
Posted On2014-10-02