Incidental Mutation 'R0180:Atxn1'
ID23849
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Nameataxin 1
Synonyms2900016G23Rik, Atx1, Sca1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location45549755-45965008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45557548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 636 (V636A)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
Predicted Effect probably damaging
Transcript: ENSMUST00000091628
AA Change: V628A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: V628A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167708
AA Change: V628A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: V628A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180110
AA Change: V636A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: V636A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222227
Meta Mutation Damage Score 0.8449 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45566931 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6272:Atxn1 UTSW 13 45567762 missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45567358 missense probably benign 0.02
R7600:Atxn1 UTSW 13 45557060 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTTCGCCATTCTCAGAGAGCACC -3'
(R):5'- AGCTCCAGCCTCTGTACATACACG -3'

Sequencing Primer
(F):5'- ATCTGTGTCTGCTGCCAG -3'
(R):5'- AGCCTCTGTACATACACGGTTTTC -3'
Posted On2013-04-16