Mutagenetix > Incidental Mutation

Incidental Mutation 'R2198:Tnks'

238494

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

040200-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2198 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34873067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 466 (D466N)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000033929
AA Change: D466N

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: D466N

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209904

Meta Mutation Damage Score

0.1347

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	G	T	7: 29,527,272		noncoding transcript	Het
Adra1a	T	C	14: 66,637,936	I120T	probably damaging	Het
Akr1c21	C	T	13: 4,577,465	P186L	probably damaging	Het
Alpk2	T	C	18: 65,350,184	K251R	probably benign	Het
Ank2	T	C	3: 126,934,577	E789G	possibly damaging	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,545,769		probably null	Het
Cacna2d4	T	C	6: 119,347,259		probably benign	Het
Carf	G	A	1: 60,141,484	R355H	probably damaging	Het
Cdh20	A	T	1: 104,947,322		probably null	Het
Celf6	G	T	9: 59,603,339	L169F	possibly damaging	Het
Cep295nl	A	T	11: 118,332,593	I475N	probably benign	Het
Chdh	T	A	14: 30,031,532	S133T	possibly damaging	Het
Cnot6l	C	T	5: 96,079,941	D478N	possibly damaging	Het
Ctnna3	C	A	10: 65,002,745	T867K	probably benign	Het
Ctse	T	G	1: 131,672,447	Y311*	probably null	Het
Ddx60	T	A	8: 61,958,063	M453K	possibly damaging	Het
Dnah9	A	G	11: 65,859,499	F3927L	possibly damaging	Het
Dsg4	T	C	18: 20,461,442	S543P	probably benign	Het
Dspp	A	T	5: 104,175,701	T237S	probably benign	Het
Eml6	T	G	11: 29,850,935	H357P	probably benign	Het
Epha3	T	C	16: 63,844,144	I38V	possibly damaging	Het
Erap1	C	T	13: 74,646,687	T155I	probably damaging	Het
Erh	T	C	12: 80,642,785		probably benign	Het
F5	A	T	1: 164,207,034	K1834M	probably damaging	Het
Fyn	A	G	10: 39,529,545	E269G	probably benign	Het
Gm4884	A	G	7: 41,040,805	T42A	probably benign	Het
Gm8979	T	A	7: 106,083,551	M166L	probably benign	Het
Grm1	T	G	10: 10,782,776	R323S	probably damaging	Het
Gstt4	T	C	10: 75,822,401	D8G	probably damaging	Het
Ldlr	A	G	9: 21,732,402	D94G	probably damaging	Het
Mrpl54	G	A	10: 81,265,741		probably null	Het
Naip2	A	T	13: 100,152,592	F1210Y	probably damaging	Het
Nifk	A	G	1: 118,329,400	R88G	probably benign	Het
Nlgn1	C	T	3: 25,433,761	M803I	probably damaging	Het
Olfr1388	C	T	11: 49,443,959	S36F	probably benign	Het
Olfr1537	G	A	9: 39,237,752	T224I	possibly damaging	Het
Olfr458	A	G	6: 42,461,016	M1T	probably null	Het
Olfr794	T	A	10: 129,571,046	Y130*	probably null	Het
Pip4k2a	A	T	2: 18,847,655	M272K	probably damaging	Het
Ppp1cb	G	T	5: 32,483,360	C139F	probably damaging	Het
Rad23b	G	A	4: 55,385,497	G345R	possibly damaging	Het
Shc4	A	T	2: 125,639,346	V548E	possibly damaging	Het
Slc26a9	A	G	1: 131,763,263		probably benign	Het
Slc8a1	T	A	17: 81,408,256	K783*	probably null	Het
Sobp	A	C	10: 43,022,524	I355S	possibly damaging	Het
Thbs4	A	G	13: 92,763,271	Y491H	possibly damaging	Het
Tle2	T	C	10: 81,590,313	V727A	probably damaging	Het
Tmprss9	C	T	10: 80,887,459	P251L	probably damaging	Het
Tonsl	A	G	15: 76,636,672	F394L	probably benign	Het
Trpa1	T	A	1: 14,910,746	Y144F	probably benign	Het
Usp22	A	G	11: 61,159,337	F324S	probably damaging	Het
Vmn1r78	G	T	7: 12,152,560	V33F	probably benign	Het
Wdr81	C	T	11: 75,446,081	R1494Q	probably benign	Het
Zc3h14	G	A	12: 98,752,809	M144I	probably damaging	Het
Zc3h14	G	A	12: 98,752,810	V145M	possibly damaging	Het
Zfp82	T	C	7: 30,057,511	T49A	probably benign	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
R9649:Tnks	UTSW	8	34838935	missense	probably damaging	0.96
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGGTAAAGGCTCTTGTGGAAC -3'
(R):5'- AGACACACTTACTCATGTCAGC -3'

Sequencing Primer
(F):5'- CACATGAAGCAAGCATGATTAGAC -3'
(R):5'- AGCCATTTTCTCTAATCCAGCATGG -3'

Posted On

2014-10-02