Incidental Mutation 'R2198:Tnks'
ID 238494
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, TANK1, tankyrase 1, 4930554K12Rik, D130072O21Rik
MMRRC Submission 040200-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2198 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 35296333-35432844 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35340221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 466 (D466N)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033929
AA Change: D466N

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: D466N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209904
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T C 14: 66,875,385 (GRCm39) I120T probably damaging Het
Akr1c21 C T 13: 4,627,464 (GRCm39) P186L probably damaging Het
Alpk2 T C 18: 65,483,255 (GRCm39) K251R probably benign Het
Ank2 T C 3: 126,728,226 (GRCm39) E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,147,493 (GRCm39) probably null Het
Cacna2d4 T C 6: 119,324,220 (GRCm39) probably benign Het
Carf G A 1: 60,180,643 (GRCm39) R355H probably damaging Het
Cdh20 A T 1: 104,875,047 (GRCm39) probably null Het
Celf6 G T 9: 59,510,622 (GRCm39) L169F possibly damaging Het
Cep295nl A T 11: 118,223,419 (GRCm39) I475N probably benign Het
Chdh T A 14: 29,753,489 (GRCm39) S133T possibly damaging Het
Cnot6l C T 5: 96,227,800 (GRCm39) D478N possibly damaging Het
Ctnna3 C A 10: 64,838,524 (GRCm39) T867K probably benign Het
Ctse T G 1: 131,600,185 (GRCm39) Y311* probably null Het
Ddx60 T A 8: 62,411,097 (GRCm39) M453K possibly damaging Het
Dnah9 A G 11: 65,750,325 (GRCm39) F3927L possibly damaging Het
Dsg4 T C 18: 20,594,499 (GRCm39) S543P probably benign Het
Dspp A T 5: 104,323,567 (GRCm39) T237S probably benign Het
Eml6 T G 11: 29,800,935 (GRCm39) H357P probably benign Het
Epha3 T C 16: 63,664,507 (GRCm39) I38V possibly damaging Het
Erap1 C T 13: 74,794,806 (GRCm39) T155I probably damaging Het
Erh T C 12: 80,689,559 (GRCm39) probably benign Het
F5 A T 1: 164,034,603 (GRCm39) K1834M probably damaging Het
Fyn A G 10: 39,405,541 (GRCm39) E269G probably benign Het
Gm4884 A G 7: 40,690,229 (GRCm39) T42A probably benign Het
Grm1 T G 10: 10,658,520 (GRCm39) R323S probably damaging Het
Gstt4 T C 10: 75,658,235 (GRCm39) D8G probably damaging Het
Gvin-ps3 T A 7: 105,682,758 (GRCm39) M166L probably benign Het
Ldlr A G 9: 21,643,698 (GRCm39) D94G probably damaging Het
Mrpl54 G A 10: 81,101,575 (GRCm39) probably null Het
Naip2 A T 13: 100,289,100 (GRCm39) F1210Y probably damaging Het
Nifk A G 1: 118,257,130 (GRCm39) R88G probably benign Het
Nlgn1 C T 3: 25,487,925 (GRCm39) M803I probably damaging Het
Or2r11 A G 6: 42,437,950 (GRCm39) M1T probably null Het
Or2y16 C T 11: 49,334,786 (GRCm39) S36F probably benign Het
Or6c88 T A 10: 129,406,915 (GRCm39) Y130* probably null Het
Or8g18 G A 9: 39,149,048 (GRCm39) T224I possibly damaging Het
Pip4k2a A T 2: 18,852,466 (GRCm39) M272K probably damaging Het
Ppp1cb G T 5: 32,640,704 (GRCm39) C139F probably damaging Het
Rad23b G A 4: 55,385,497 (GRCm39) G345R possibly damaging Het
Shc4 A T 2: 125,481,266 (GRCm39) V548E possibly damaging Het
Slc26a9 A G 1: 131,691,001 (GRCm39) probably benign Het
Slc8a1 T A 17: 81,715,685 (GRCm39) K783* probably null Het
Sobp A C 10: 42,898,520 (GRCm39) I355S possibly damaging Het
Thbs4 A G 13: 92,899,779 (GRCm39) Y491H possibly damaging Het
Tle2 T C 10: 81,426,147 (GRCm39) V727A probably damaging Het
Tmprss9 C T 10: 80,723,293 (GRCm39) P251L probably damaging Het
Tonsl A G 15: 76,520,872 (GRCm39) F394L probably benign Het
Trpa1 T A 1: 14,980,970 (GRCm39) Y144F probably benign Het
Usp22 A G 11: 61,050,163 (GRCm39) F324S probably damaging Het
Vmn1r78 G T 7: 11,886,487 (GRCm39) V33F probably benign Het
Wdr81 C T 11: 75,336,907 (GRCm39) R1494Q probably benign Het
Wdr87-ps G T 7: 29,226,697 (GRCm39) noncoding transcript Het
Zc3h14 G A 12: 98,719,068 (GRCm39) M144I probably damaging Het
Zc3h14 G A 12: 98,719,069 (GRCm39) V145M possibly damaging Het
Zfp82 T C 7: 29,756,936 (GRCm39) T49A probably benign Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 35,328,843 (GRCm39) splice site probably benign
IGL00901:Tnks APN 8 35,305,549 (GRCm39) nonsense probably null
IGL01448:Tnks APN 8 35,307,136 (GRCm39) missense probably damaging 1.00
IGL01455:Tnks APN 8 35,408,054 (GRCm39) missense probably damaging 0.99
IGL01962:Tnks APN 8 35,336,678 (GRCm39) missense probably damaging 1.00
IGL02088:Tnks APN 8 35,307,148 (GRCm39) missense possibly damaging 0.50
IGL02260:Tnks APN 8 35,310,137 (GRCm39) missense probably damaging 0.99
IGL02454:Tnks APN 8 35,298,882 (GRCm39) unclassified probably benign
IGL02486:Tnks APN 8 35,318,352 (GRCm39) missense probably damaging 1.00
IGL02612:Tnks APN 8 35,316,453 (GRCm39) missense possibly damaging 0.48
IGL03179:Tnks APN 8 35,315,824 (GRCm39) missense probably benign 0.38
IGL03404:Tnks APN 8 35,407,858 (GRCm39) missense probably damaging 1.00
R0256:Tnks UTSW 8 35,328,701 (GRCm39) missense probably benign 0.07
R0265:Tnks UTSW 8 35,307,124 (GRCm39) nonsense probably null
R0334:Tnks UTSW 8 35,320,413 (GRCm39) nonsense probably null
R0414:Tnks UTSW 8 35,320,463 (GRCm39) missense probably damaging 1.00
R0526:Tnks UTSW 8 35,320,457 (GRCm39) missense probably benign 0.23
R0622:Tnks UTSW 8 35,407,976 (GRCm39) missense probably damaging 1.00
R1445:Tnks UTSW 8 35,301,757 (GRCm39) splice site probably benign
R1618:Tnks UTSW 8 35,342,430 (GRCm39) missense probably damaging 1.00
R1779:Tnks UTSW 8 35,324,672 (GRCm39) missense probably benign 0.18
R1919:Tnks UTSW 8 35,342,386 (GRCm39) missense probably damaging 1.00
R1938:Tnks UTSW 8 35,305,684 (GRCm39) missense probably damaging 1.00
R2018:Tnks UTSW 8 35,318,260 (GRCm39) missense probably damaging 1.00
R2198:Tnks UTSW 8 35,315,803 (GRCm39) missense probably benign
R2925:Tnks UTSW 8 35,432,815 (GRCm39) missense unknown
R3828:Tnks UTSW 8 35,340,332 (GRCm39) missense probably damaging 1.00
R3913:Tnks UTSW 8 35,340,228 (GRCm39) missense probably damaging 0.99
R3916:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3917:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3930:Tnks UTSW 8 35,407,966 (GRCm39) missense probably damaging 1.00
R4659:Tnks UTSW 8 35,316,465 (GRCm39) missense possibly damaging 0.53
R4760:Tnks UTSW 8 35,318,937 (GRCm39) missense probably benign 0.38
R5091:Tnks UTSW 8 35,308,963 (GRCm39) missense probably benign 0.40
R5419:Tnks UTSW 8 35,432,720 (GRCm39) missense unknown
R5558:Tnks UTSW 8 35,432,819 (GRCm39) start codon destroyed probably null
R5582:Tnks UTSW 8 35,408,015 (GRCm39) missense probably benign 0.14
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6495:Tnks UTSW 8 35,307,120 (GRCm39) critical splice donor site probably null
R6527:Tnks UTSW 8 35,340,247 (GRCm39) missense probably benign 0.36
R6991:Tnks UTSW 8 35,301,647 (GRCm39) missense probably damaging 1.00
R7015:Tnks UTSW 8 35,305,701 (GRCm39) missense probably benign 0.04
R7038:Tnks UTSW 8 35,318,790 (GRCm39) missense probably damaging 0.99
R7057:Tnks UTSW 8 35,307,168 (GRCm39) missense probably damaging 1.00
R7167:Tnks UTSW 8 35,316,458 (GRCm39) missense probably damaging 0.98
R7250:Tnks UTSW 8 35,318,912 (GRCm39) missense probably damaging 0.98
R7475:Tnks UTSW 8 35,298,866 (GRCm39) missense probably damaging 1.00
R7790:Tnks UTSW 8 35,328,694 (GRCm39) missense probably benign 0.01
R7818:Tnks UTSW 8 35,340,182 (GRCm39) missense probably benign 0.03
R7909:Tnks UTSW 8 35,407,858 (GRCm39) missense probably damaging 1.00
R7970:Tnks UTSW 8 35,323,080 (GRCm39) critical splice donor site probably null
R8341:Tnks UTSW 8 35,340,199 (GRCm39) missense probably damaging 1.00
R8343:Tnks UTSW 8 35,301,738 (GRCm39) missense probably benign 0.03
R8870:Tnks UTSW 8 35,314,433 (GRCm39) critical splice donor site probably null
R8936:Tnks UTSW 8 35,320,501 (GRCm39) nonsense probably null
R9049:Tnks UTSW 8 35,308,932 (GRCm39) missense probably damaging 0.96
R9080:Tnks UTSW 8 35,432,466 (GRCm39) small deletion probably benign
R9182:Tnks UTSW 8 35,308,905 (GRCm39) critical splice donor site probably null
R9211:Tnks UTSW 8 35,316,489 (GRCm39) missense probably damaging 1.00
R9425:Tnks UTSW 8 35,340,819 (GRCm39) missense probably damaging 1.00
R9649:Tnks UTSW 8 35,306,089 (GRCm39) missense probably damaging 0.96
Z1177:Tnks UTSW 8 35,432,299 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGTAAAGGCTCTTGTGGAAC -3'
(R):5'- AGACACACTTACTCATGTCAGC -3'

Sequencing Primer
(F):5'- CACATGAAGCAAGCATGATTAGAC -3'
(R):5'- AGCCATTTTCTCTAATCCAGCATGG -3'
Posted On 2014-10-02