Mutagenetix > Incidental Mutation

Incidental Mutation 'R2198:Ddx60'

238496

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

040200-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R2198 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61958063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 453 (M453K)

Ref Sequence

ENSEMBL: ENSMUSP00000122841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]

AlphaFold

E9PZQ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070631
AA Change: M453K

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: M453K

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: M453K

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: M453K

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154398
AA Change: M453K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: M453K

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	G	T	7: 29,527,272		noncoding transcript	Het
Adra1a	T	C	14: 66,637,936	I120T	probably damaging	Het
Akr1c21	C	T	13: 4,577,465	P186L	probably damaging	Het
Alpk2	T	C	18: 65,350,184	K251R	probably benign	Het
Ank2	T	C	3: 126,934,577	E789G	possibly damaging	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,545,769		probably null	Het
Cacna2d4	T	C	6: 119,347,259		probably benign	Het
Carf	G	A	1: 60,141,484	R355H	probably damaging	Het
Cdh20	A	T	1: 104,947,322		probably null	Het
Celf6	G	T	9: 59,603,339	L169F	possibly damaging	Het
Cep295nl	A	T	11: 118,332,593	I475N	probably benign	Het
Chdh	T	A	14: 30,031,532	S133T	possibly damaging	Het
Cnot6l	C	T	5: 96,079,941	D478N	possibly damaging	Het
Ctnna3	C	A	10: 65,002,745	T867K	probably benign	Het
Ctse	T	G	1: 131,672,447	Y311*	probably null	Het
Dnah9	A	G	11: 65,859,499	F3927L	possibly damaging	Het
Dsg4	T	C	18: 20,461,442	S543P	probably benign	Het
Dspp	A	T	5: 104,175,701	T237S	probably benign	Het
Eml6	T	G	11: 29,850,935	H357P	probably benign	Het
Epha3	T	C	16: 63,844,144	I38V	possibly damaging	Het
Erap1	C	T	13: 74,646,687	T155I	probably damaging	Het
Erh	T	C	12: 80,642,785		probably benign	Het
F5	A	T	1: 164,207,034	K1834M	probably damaging	Het
Fyn	A	G	10: 39,529,545	E269G	probably benign	Het
Gm4884	A	G	7: 41,040,805	T42A	probably benign	Het
Gm8979	T	A	7: 106,083,551	M166L	probably benign	Het
Grm1	T	G	10: 10,782,776	R323S	probably damaging	Het
Gstt4	T	C	10: 75,822,401	D8G	probably damaging	Het
Ldlr	A	G	9: 21,732,402	D94G	probably damaging	Het
Mrpl54	G	A	10: 81,265,741		probably null	Het
Naip2	A	T	13: 100,152,592	F1210Y	probably damaging	Het
Nifk	A	G	1: 118,329,400	R88G	probably benign	Het
Nlgn1	C	T	3: 25,433,761	M803I	probably damaging	Het
Olfr1388	C	T	11: 49,443,959	S36F	probably benign	Het
Olfr1537	G	A	9: 39,237,752	T224I	possibly damaging	Het
Olfr458	A	G	6: 42,461,016	M1T	probably null	Het
Olfr794	T	A	10: 129,571,046	Y130*	probably null	Het
Pip4k2a	A	T	2: 18,847,655	M272K	probably damaging	Het
Ppp1cb	G	T	5: 32,483,360	C139F	probably damaging	Het
Rad23b	G	A	4: 55,385,497	G345R	possibly damaging	Het
Shc4	A	T	2: 125,639,346	V548E	possibly damaging	Het
Slc26a9	A	G	1: 131,763,263		probably benign	Het
Slc8a1	T	A	17: 81,408,256	K783*	probably null	Het
Sobp	A	C	10: 43,022,524	I355S	possibly damaging	Het
Thbs4	A	G	13: 92,763,271	Y491H	possibly damaging	Het
Tle2	T	C	10: 81,590,313	V727A	probably damaging	Het
Tmprss9	C	T	10: 80,887,459	P251L	probably damaging	Het
Tnks	A	T	8: 34,848,649	D994E	probably benign	Het
Tnks	C	T	8: 34,873,067	D466N	probably benign	Het
Tonsl	A	G	15: 76,636,672	F394L	probably benign	Het
Trpa1	T	A	1: 14,910,746	Y144F	probably benign	Het
Usp22	A	G	11: 61,159,337	F324S	probably damaging	Het
Vmn1r78	G	T	7: 12,152,560	V33F	probably benign	Het
Wdr81	C	T	11: 75,446,081	R1494Q	probably benign	Het
Zc3h14	G	A	12: 98,752,809	M144I	probably damaging	Het
Zc3h14	G	A	12: 98,752,810	V145M	possibly damaging	Het
Zfp82	T	C	7: 30,057,511	T49A	probably benign	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
R9766:Ddx60	UTSW	8	62012278	missense	probably damaging	1.00
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TATGTTCCAAAAGACTCAATGTGGG -3'
(R):5'- GTCTTCAACACTCAAACATTGCTTG -3'

Sequencing Primer
(F):5'- CAATGTGGGAAATAGTTTTATGTGC -3'
(R):5'- GATGTCATAAAGAAGGTCAACAGAC -3'

Posted On

2014-10-02