Incidental Mutation 'R2198:Ldlr'
ID 238497
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission 040200-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2198 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 21723483-21749919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21732402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000149431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably damaging
Transcript: ENSMUST00000034713
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: D94G

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213114
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217613
Meta Mutation Damage Score 0.9696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21735361 critical splice donor site probably null
IGL01975:Ldlr APN 9 21733697 missense probably benign 0.05
IGL02043:Ldlr APN 9 21733499 missense probably benign 0.03
IGL02524:Ldlr APN 9 21733681 missense probably damaging 1.00
IGL03049:Ldlr APN 9 21745819 missense probably benign 0.00
IGL03113:Ldlr APN 9 21739828 missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21737999 splice site probably benign
R0586:Ldlr UTSW 9 21739744 missense probably benign 0.00
R1398:Ldlr UTSW 9 21739542 missense probably benign 0.01
R1587:Ldlr UTSW 9 21737913 missense probably damaging 0.99
R3730:Ldlr UTSW 9 21731801 missense probably benign 0.09
R4422:Ldlr UTSW 9 21737952 missense probably damaging 1.00
R5044:Ldlr UTSW 9 21735242 missense probably benign 0.00
R5046:Ldlr UTSW 9 21745907 critical splice donor site probably null
R6186:Ldlr UTSW 9 21723759 start gained probably benign
R6195:Ldlr UTSW 9 21731781 nonsense probably null
R6523:Ldlr UTSW 9 21737253 missense probably damaging 1.00
R6682:Ldlr UTSW 9 21732375 missense probably benign
R7256:Ldlr UTSW 9 21745744 missense probably benign 0.01
R7384:Ldlr UTSW 9 21739794 missense probably benign 0.07
R7823:Ldlr UTSW 9 21742306 critical splice donor site probably null
R8065:Ldlr UTSW 9 21737945 missense probably damaging 1.00
R8223:Ldlr UTSW 9 21747250 missense probably damaging 1.00
R8732:Ldlr UTSW 9 21739689 missense probably benign 0.00
R8931:Ldlr UTSW 9 21731812 missense probably damaging 0.99
R8954:Ldlr UTSW 9 21739532 missense possibly damaging 0.87
R9315:Ldlr UTSW 9 21733486 splice site probably benign
R9489:Ldlr UTSW 9 21735330 missense probably damaging 1.00
R9517:Ldlr UTSW 9 21743944 missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21735330 missense probably damaging 1.00
R9709:Ldlr UTSW 9 21745839 missense probably benign 0.00
X0024:Ldlr UTSW 9 21739818 missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21739830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGACCAGCCTTCACACAC -3'
(R):5'- CGCTCACACATACACTGAGG -3'

Sequencing Primer
(F):5'- AGCCTTCACACACACACAC -3'
(R):5'- GGCACTCTCGAACGCAC -3'
Posted On 2014-10-02