Incidental Mutation 'R2198:Olfr1537'
List |< first << previous [record 36 of 58] next >> last >|
ID238498
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39237752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 224 (T224I)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: T227I

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: T227I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213472
AA Change: T224I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1224:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1355:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R1815:Olfr1537 UTSW 9 39237990 missense probably benign 0.01
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R6850:Olfr1537 UTSW 9 39237975 missense probably benign 0.01
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
R7573:Olfr1537 UTSW 9 39237681 missense probably benign 0.42
R7715:Olfr1537 UTSW 9 39237878 missense probably damaging 1.00
R7722:Olfr1537 UTSW 9 39237589 nonsense probably null
R7729:Olfr1537 UTSW 9 39238250 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTCAGGCTGTAGATCAAGGG -3'
(R):5'- CTGGCTTCATGCTTAGGACTC -3'

Sequencing Primer
(F):5'- CTGTAGATCAAGGGGTTCAGC -3'
(R):5'- ATGCTTAGGACTCAGTTCTGC -3'
Posted On2014-10-02